More posts like this
-
Where to download refseq gene data
written by 897598644 11Excuse me: Where can I download the refseq gene coding regions data? Is it from UCSC? I would be much appreciated if you gave me …
-
Whole genomic amplification samples for whole exome sequencing
written by 897598644 11Excuse me : I want to sequence some samples with tiny amount of DNA. Could we use the whole genomic amplification samples? I am concerned …
-
Recurrent de novo mutation
written by 897598644 11Excuse me: I want to know the exact definition of recurrent de novo mutation. But wiki did show that. Any link or paper related with …
-
Bedtools output fasta format files?
written by 897598644 11Excuse me: After I got sequences with command: `bedtools/fastaFromBed -fi /ucsc.hg19.fasta -bed /range.bed -fo /range.out.fasta`, the output file is like: ``` >chr2:200172828-200174428 AGTGTCAGTAGTTAAACTCAATT ``` I …
-
DNAssist for win7/win8 64 bit download
written by 897598644 11Excuse me: I want to get DNAssist for win7/win8 64 bit version. I would be much grateful if you gave me some links. Thanks in …
-
Term of throughput in next generation sequencing
written by 897598644 11Excuse me: How shou'd I understand the concept of throughput? Does it mean the length of read or the output data amount or the speed …
-
Paired end sequencing and single end sequencing in next generation sequencing of Illumina platform
written by 897598644 11Excuse me: Is there any paper that introduces the procedure of paired end sequencing and single end sequencing in next generation sequencing of Illumina platform? …
-
1000 Genome Project and ESP for indel or frameshift
written by 897598644 11Excuse me: After calling variants of indel and frameshift, I wanted to annotate them using 1000 Genome Project and ESP.Could I get the frequency of …
-
how many bases in the number of inter-individual difference on average ?
written by 897598644 11Excuse me I want to know how many bases there are in the number of inter-individual differences for the whole genome or whole exome. Any …
-
base quality in the result of mpileup
written by 897598644 11Excuse me: When I analyzed the reads of variants, I used command of samtools mpileup and it printed out six colums. In the last column, …
Did you search for that? I know that google is potentially blocked in china, but there are other search engines. Please don't post email addresses or invite to off-board conversation. emailing the software to you would possibly be a copyright breach anyway.
There might not be a 64 bit version, but you should send any requests to the author of that software.
Hello 897598644!
We believe that this post does not fit the main topic of this site.
can be searched easily
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!