This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Converting A Microarray Dataset Into Fasta Files

I have GenBank accession numbers and gene symbols from my Agilent microarray.

A_55_P2051983    FALSE    NM_001001803    Spink7    serine peptidase inhibitor, Kazal type 7 (putative)    Mus musculus serine peptidase inhibitor, Kazal type 7 (putative) (Spink7), mRNA [NM_001001803]    GO:0005576|GO:0004867|GO:0030414    chr18:62753954-62753895        CAGTTTGTGGATCTGACTATATCACTTACGGGAATAAATGCAAGCTGTGTACAGAGATCT

I would like to convert all of these into one fasta file. Any advice would be appreciated.

Thanks,
Stephen

microarray fasta
• 2,937 views • link
updated by Ram Ram • written by Stephanhart • Stephanhart

So you in fact want to get a fasta file with the full DNA sequence of the transcript or gene that the reporter sequence matches? (Pierre's answer was seemingly correct for the question in the way you posed it.) If that is what you want you have to specify if you want gene or transcript sequence and which transcript to take if there are multiple transcripts. You can get this information from e.g. biomart using a list of accession numbers.

• 1 views • link
written by Michael Dondrup Michael Dondrup

2 answers

awk -F ' ' '{printf(">"); for(i=1;i[?] result.fa

Edit:

cat yourlist.txt | cut -f 3 |\
while read L
   do
     A=`echo -n $L |cut -d ' ' -f 3`
     curl -s "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=${A}&retmode=text&rettype=fasta"
   done
• 1 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thank you. The script did convert my txt file to fasta format. But I don't think I was entirely clear. This is the output from your script:

A_55_P2051983 FALSE NM_001001803 Spink7 serine peptidase inhibitor, Kazal type 7 (putative) Mus musculus serine peptidase inhibitor, Kazal type 7 (putative) (Spink7), mRNA [NM_001001803] GO:0005576|GO:0004867|GO:0030414 chr18:62753954-62753895 CAGTTTGTGGATCTGACTATATCACTTACGGGAATAAATGCAAGCTGTGTACAGAGATCT

But this shows only a partial sequence. The entire sequence, from NCBI, is this

gi|254675241|ref|NM_001001803.2| Mus musculus serine peptidase inhibitor, Kazal type 7 (putative) (Spink7), mRNA ATGAAGCTTGTTGGTGGTCTCCTGCTGCTCTTCGCAGCAACCTATGTCTGCAACTGCTCTGAAGTTACTAGCCACCCTTCAGCAACAGTGGACTGTGACATATACAAGAAGTACCCAGTGGTGGCCATCCCTTGCCCCATTGTAAACATACCAGTTTGTGGATCTGACTATATCACTTACGGGAATAAATGCAAGCTGTGTACAGAGATCTTGAGAAGCAATGGAAAAATCCAGTTTCTTCATGAAGGGCACTGCTGA

So, is there any way to go from the partial sequence I have from my microarray data to a fasta file with the complete sequence? Hopefully this is clearer.

Thanks, Stephen

• 0 views • link
updated by Neilfws Neilfws • written by Stephanhart • Stephanhart

Please edit your question rather than putting this as an answer.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Log in to answer this question.

More posts like this