Hi,
I used trimmomatics to trim my Illumina Hiseq reads with a list that I downloaded from here.
But after I assembled the trimmed reads, I tried to upload the assembly to the TSA database in NCBI, they gave me the error saying that my sequence is contaminated by primer sequences. I found one of the contamination sources using vector screen, which is CCCTACACGACGCTCTTCCGATCT. But this sequence is actually contained in one of the adapter sequences in the list:
>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
So my question is why the sequence is not trimmed off by trimmomatics?
Is there anyway to remove the contamination from the assembly. So I don't have to go back to reassemble the sequences?
•
written
by
szc0049 •
2 answers
Trimming does not look for all subsequences of the adapter. It only detects the adapters from their start and then continuing towards the end (at variable lengths). Normally this is the way adapters show up. In your case it seems more oddities are present.
•
written
by
Istvan Albert
Your assembly is very likely incorrect.
The adapter contamination in two reads will provide a common region that may lead the assembler to join these two into a single contig. Thus potentially connecting regions that are not actually adjacent.
You will need to filter out the reads that contain contaminants by aligning the reads against these contaminants, removing reads that aligned and reassembling with the remaining reads.
•
written
by
Istvan Albert
Trimming accuracy varies in different trimmers. I'd recommend atria to determine and trim the adapter sequences. It is a newly-published cutting-edge trimmer with exceptional precision and speed.
To find a concise trimming benchmarks, you can click here.
You can also find more comprehensive trimming benchmark at Atria's paper.
To check if your trimmer is behaving as expected, it's good to visualise the output. Trimviz can do that if you just feed it your pre-trimmed and post-trimmed fastq files. https://github.com/MonashBioinformaticsPlatform/trimviz
Log in to answer this question.
-
How to trim transcripts using information from NCBI contamination screen report
written by Lada •
-
Is there a paired-end assembler for Illumina sequences that preserves the primers and inline barcod…
written by J.E. •
-
Obtain identity of sequences aligned by msa in r
written by Debjyoti •
-
Removing Illumina PCR primer sequences from TSA for GenBank upload
written by Michael Dondrup
-
Adapter sequences for stranded paired end data
written by GR
-
how to identify degenerate primers in reads
written by genya35 •
-
Trimming sequences based on NCBI contamination screen report
written by T_18 •
-
Possible tiny amount of adaptor sequence left
written by GLFR •
-
rRNA contamination in poly A-enriched libraries
written by seta
-
Remove Illumina TruSeq Index adapters
written by enricoferrero
