This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Creating A Gff File With A Nonstandard Attribute

Hello

I am trying to use HTSeq to map counts from an RNASeq assay in order to preform a differential expression analysis on lincRNAs. I have a lisf of the lincRNAs I want to use in the analysis in a BED file, which I converted into a GFFfile using Galaxy's bed_to_gtf_convertor script. An example attribute line from my file:

exon linc|3P|XLOC_000004|TCONS_00000005:2.63081|141AA|61AA|;

The problem is that lincRNAs are not a standard attribute in GFF files attribute columns, so when I attempted run the HTSeq.counts setting idattr to 'linc', I received the following error message:

“Feature linc|3P|XLOC_000004|TCONS_00000005:2.63081|141AA|61AA| does not contain a 'linc' attribute”

since the string 'linc' does appear in many rows of my file's attribute column, I suspect something may be wrong with the attribute strings formatting (wrong delimiters etc.), but am not sure what would be the correct format.

I will appreciate any advice on how to format these strings, or any other ideas on how I can make the attribute column useable

Thanks in advance

gff htseq
• 2,251 views • link
updated by Devon Ryan Devon Ryan • written by dolevrahat • dolevrahat

1 answer

The example you posted contains a "Feature" attribute that happens to contain the word "linc" in it. If the file only contains lincRNAs, then just set the idattr to "Feature".

• 19 views • link
written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this
  • Specifiying A Data Attribute In Multiple Instasnces Of The Same Class
    written by xgeneral57 • xgeneral57
    <p>I am defining a class like this:</p> <pre><code>&gt;&gt;&gt; class foo(object): ... def __init__(self,x): ... self.x = x ... &gt;&gt;&gt; </code></pre> <p>I next define an instance …
  • Cgat Tools Install Error
    written by liupfskygre liupfskygre
    <p>Dear all, I am trying to install cgat tool. Following the instruction, </p> <p><a href='https://github.com/CGATOxford/cgat/'>https://github.com/CGATOxford/cgat/</a> </p> <pre><code>pip install cgat </code></pre> <p>or download and install by</p> …
  • Iteratively Concatenate An Arbitrary Number Of Seq Objects Using Biopython
    written by mossmatters • mossmatters
    <p>What is the best way to join multiple Seq objects together into one sequence?</p> <p>The <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec22'>Biopython tutoria</a>l suggests using "+" to join the sequence …
  • Problem In Cuffdiff Output
    written by thakkar.bjl • thakkar.bjl
    <p>i have some problem related to cuffidiff output, i used this command for replicates:</p> <pre><code>cuffdiff -o diff_out -b genome/genome.fa -p 10 -L CT,SS --total-hits-norm -u …
  • R: Parsing Fasta From Strings In R?
    written by Chris Warth Chris Warth
    <p>My goal is to retrieve DNA gene sequence from NCBI using R, but I get stuck trying to parse FASTA sequences from strings. </p> <p>I …
  • Isomir Discovery Or Sequencing Contaminants?
    written by Agatha • Agatha
    <p>Considering the RNA-seq contaminants list:</p> <pre><code>Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA Illumina 5p RNA Adapter GTTCAGAGTTCTACAGTCCGACGATC Illumina RNA Adapter1 TCGTATGCCGTCTTCTGCTTGT Illumina Small RNA 3p Adapter …
  • Perl Pattern Matching Compare 2 Strings
    written by Freemira • Freemira
    <p>I have 2 strings as follows: <code>$a='ccgctaccgcgatac'</code> and <code>$b='ccgatacgcatcacata'</code></p> <p>I have to get all the common substring of a determined length <code>$c</code> </p> <p>i.e if …
  • A Result From Mummer Alignment
    written by Love • Love
    <p>Hello, I run the mummer command for a pairwaise alignment</p> <pre><code>mummer -s -mum refer.txt query.txt &gt; refer_query.align </code></pre> <p>The result is:</p> <pre><code>&gt; query 1450 9370 …
  • Extracting Single Chains From A Pdb File Using Edpdb Module
    written by satsurae • satsurae
    <p>I am trying to extract individual chains from a pdb file using the edPDB module. In python I load the module then:</p> <pre><code>&gt;&gt;&gt; edPDB.xpdb.write_pdb(structure='1ES7.pdb',filename='1ES7_B2.pdb', chain='B') …
  • Bio Sequtils, Protparam Useage Inquiry
    written by Jesse • Jesse
    <p>I'm trying to use the ProtParamData module, but am receiving: AttributeError: 'Seq' object has no attribute 'islower' in reference to this function of the class …