This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Write Sequences To Fasta Format Using Seqio And Seqrecord

I've a set of sequences like :-

sequenceset = ['AGATAAGTTCACGTTACCAT', 'GTATT', 'TAGATGAAGCGGGATAGTCTTTTTCTGATATGCACTTATCAGTTCACTAGCAGT', 'ACTGAACGTGATTGATGAAGCT', 'ATCTA']

i converted them into SeqRecord Objects:-

for records in sequenceset:
my_seqs = SeqRecord(Seq(records,IUPAC.DNA), id = randomsequence)

now how can i write this to a file in fasta format ?

I tried :-

handle = open(file_location,"w")
for sequences in my_seqs:
SeqIO.write(sequences,handle,"fasta")

But this shows error :

AttributeError: 'str' object has no attribute 'id'
biopython

python is indentation specific, please fix your indentation in you code fragments, also what is
"randomsequence", is it defined elsewhere? I suggest to put the complete code, and put it in one block.

You're missing bits of code here (e.g. the import lines). As Michael wrote, putting a complete example is a good idea.

I've reverted the code back to randomsequence not having quotes, as it keeps the question logical in respect to the answer given by Dk.

2 answers

The error message is telling you that the things that you have in my_seqs are strings, not SeqRecords. In any case, because you've assigned my_seqs in a for loop it would only contain the last sequence

If I understand you, you're trying to write all those sequence to a single fasta file?

If that's the case then note SeqIO.write() can take a list or a generator of SeqRecords so you should pass one of those. Here's a generator expression :

records = (SeqRecord(Seq(seq, generic_dna), str(index)) for index,seq in enumerate(sequence_set) )
SeqIO.write(records, file_location, "fasta")

Note you don't have to use a file handle in recent versions of Biopython (a string is fine) an you could create a list of SeqRecords to write to file using a for loop if you don't like generator or list expressions (I think they're neat, but others disagree)

records = []
for (index, seq) in enumerate(sequenceset):
    records.append(SeqRecord(Seq(seq, generic_dna), str(index))

Did you put quotes around the id name?

So instead of:

my_seqs = SeqRecord(Seq(records,IUPAC.DNA), id = randomsequence)

Do this:

my_seqs = SeqRecord(Seq(records,IUPAC.DNA), id = "randomsequence")

WIthout quotes, randomsequence is referring to a variable.

Log in to answer this question.