Hello, I run the mummer command for a pairwaise alignment
mummer -s -mum refer.txt query.txt > refer_query.align
The result is:
> query
1450 9370 21
gaggttgcagtgagctgagat
2122 9771 21
caaaaaaaaaaaaaaaaaaaa
3296 9570 26
gaggtcaggagatcgagaccatcctg
3318 9243 20
cctgaccaacatggtgaaac
3428 9353 30
cttgaacctgggaggcagaggttgcagtga
3461 9386 20
gagatcatgccactgcactc
3502 9773 20
aaaaaaaaaaaaaaaaaaag
My question is the result seems only display the matched strings in the query sequence. Can we also show the ones in the reference sequence?
1 answer
I wonder what kind of alignment view you want or you need any specific format to parse with perl or python. The usual way I do nucleotide alignment with mummer is following:
align the two sequences
nucmer -p out seq1.fa seq2.fa
filter the results (delta format)
delta-filter -g -u 95 out.delta > out.fil.delta
show the alingment records (matching string coordinates)
show-coords -c -l -r -T out.fil.delta > out.fil.coords
show alignments for the regions you want (something like clustalw results)
show-aligns -r .....
I think you may need to filter based on identity at delta-filter part then use 'show-coords' to find the coordinates, then fetch the sequences from seq1 and seq2. There are a lot more stuff in the manual that I can't remember but I'm sure you'll find solutions there.
Log in to answer this question.
If you are interested in variants, you can try dnadiff from MUMmer.