This is a test version of Biostars. For the public version, visit https://www.biostars.org.
error in Fastq

HI I am trying to do fastqc of one file but after running approximately 100 percent it is showing the below-listed error Please suggest what can be done. Thanks

Approx 100% complete for SRR18330177_2.fastq
It seems our guess for the total number of records wasn't very good.  Sorry about that.
Still going at 105% complete for SRR18330177_2.fastq
Still going at 110% complete for SRR18330177_2.fastq
Still going at 115% complete for SRR18330177_2.fastq
Failed to process file SRR18330177_2.fastq
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'F:GAATAA7FFFFFFFFFFFFCCCTCGCCCACCATTCCCAAACTCFFFFF:F,F:F,,' didn't start with '+' at 72176579
        at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:179)
        at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:129)
        at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:77)
        at java.base/java.lang.Thread.run(Thread.java:829)
everyone
• 1,740 views • link
updated by Ram Ram • written by lonekaisar72 • lonekaisar72

what are the outputs of

file SRR18330177_2.fastq

and

head SRR18330177_2.fastq
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Your file is corrupted. Better to get fresh copy of it.

• 0 views • link
written by bk11 • bk11

1 answer

Midline 'F:GAATAA7FFFFFFFFFFFFCCCTCGCCCACCATTCCCAAACTCFFFFF:F,F:F,,' didn't start with '+' at 72176579

Looks like your file is corrupt with at least one malformed fastq record. Please redownload.

• 0 views • link
written by GenoMax GenoMax

Fix this post by adding a proper tag and removing the everyone tag.

• 0 views • link
written by Ram Ram

Log in to answer this question.

More posts like this
  • Fastqc Exception Problem
    written by Maliha • Maliha
    Hello, I am running fastqc on Ubuntu 20.04.4 LTS. While doing that, after some time this error message is coming up- > Exception in thread …
  • Fastqc genome reads
    written by Ak • Ak
    Hi! I'm trying to check the quality of my raw genome reads using fastqc, but I'm encountering this issue. Does anyone what can I do …
  • bbduk truncated fastq file according to FastQC - help?
    written by lintonf • lintonf
    I was able to succeessfully remove adapters from my PE 150bp x 2 reads using bbduk.sh, but I kept seeing that I had a long …
  • FastQC error (failure to process fastq.gz file)
    written by mdmoandd • mdmoandd
    I was wondering why I got this error when using fastqc. Do I need to unzip my fastq.gz file first maybe? Started analysis of 16_2.fastq.gz …
  • Failure in generating fastq from human fasta
    written by marongiu.luigi marongiu.luigi
    Hello, I have created some mutated human sequences modifying the GCRh38 fasta files. I then concatenated the files adn generated the fastq files with $ …
  • How to repair corrupted fastq files after sortmeRNA
    written by SMILE SMILE
    Hi all, After removing rRNA in the fastq files with sortmeRNA, one of the paied reads was corrupetd, which failed to do fastqc with error: …
  • tophat equal length problem
    written by HK • HK
    Hey, I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error: prep_reads v2.1.1 …
  • tophat equal length problem
    written by HK • HK
    Hey, I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error: prep_reads v2.1.1 …
  • RNA-seq fastqc error
    written by zz105 • zz105
    I'm running fastqc on command line, and one of the files gives me a error: sun-java version jdk1.7.0_02 loaded fastqc version 0.10.1 loaded Started analysis …
  • fastq file error
    written by Pals Pals
    Hi, After removing rRNAs using sortmerna, 2/42 files failed fastqc with error: > uk.ac.babraham.FastQC.Sequence.SequenceFormatException: ID line didn't > start with '@' at > uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:158) > …