tophat equal length problem
Hey,
I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error:
prep_reads v2.1.1 (ecf7617)
---------------------------
Error: qual length (76) differs from seq length (45) for fastq record !
gzip: stdout: Broken pipe
Stange that all the other worked perfectly. Then i tried fastqc to check the quality and it shopped at 65% and gave the error:
Approx 55% complete for 102842-001-042_R1.fastq.gz
Approx 60% complete for 102842-001-042_R1.fastq.gz
Approx 65% complete for 102842-001-042_R1.fastq.gz
Failed to process file 102842-001-042_R1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'GACTGATTCGTCTGG AGTTACCATTCCCTGTGGCTC' didn't start with '+'
at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:172)
at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:125)
at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java :76)
at java.lang.Thread.run(Thread.java:701)
Now i am clueless, what to do. I did not do any trimming as all the pre-processing was done my the company who gave the sequencing samples.
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
error in Fastq
written by lonekaisar72 •
-
Fastqc genome reads
written by Ak •
-
bbduk truncated fastq file according to FastQC - help?
written by lintonf •
-
FastQC error (failure to process fastq.gz file)
written by mdmoandd •
-
Failure in generating fastq from human fasta
written by marongiu.luigi
-
How to repair corrupted fastq files after sortmeRNA
written by SMILE
-
tophat equal length problem
written by HK •
-
Failed in Fastqc, wiht out final report
written by mafer_309 •
-
RNA-seq fastqc error
written by zz105 •
-
fastq file error
written by Pals
Hello HK!
Questions similar to yours can already be found at:
We have closed your question to allow us to keep similar content in the same thread.
If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.
Cheers!
well i have read that thread , but did not get any solution from that. thats why i am posting again.
You posted the same question twice. That is why I closed this copy so we don't have two parallel conversations.