Finding structurally full-length retroelements
Hello everyone! Please help me how can I find structurally full-length retroelements distributed across chromosome? For example, I have a file with annotated clusters with the following sequence:
>RLX_02.01.01.99_LTR-scaffold_11709_001-v2_chr1A_71261717_71261828|RLX_02.01.01.99_LTR-scaffold_11709_001-v2_chrUn_830094_830205|3741
TGCAAATGGGGCTAAGAGCCCTGAAGAATAACCAATGGCGTCCATAACCCTGCCCAGGCCAAGCCGGAAGGGTAACCCTGCTAACGACGTCGATCTCAAAACCTGCTTAAAC
How can I figure out whether it is a full-lenght retrotransposon or truncated?
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Analyzing PCA Clustering from PLINK Output
written by Smriti •
-
inquiry related to same SNP for a gene across for two tissues
written by rheab1230 •
-
unique k-mers
written by Юлия •
-
Overlapping the novel lncRNAs on mitranscriptome lncRNAs
written by newbie
-
Extract gene ids from DESeq2 result dataframe for specific comparison based on vennDiagram
written by bioinfo8
-
GO analysis of genes with SNPs and chromsomes
written by padmoo •
-
how to normalize chromosome arms?
written by mangfu100
-
Phylogeny using UTR sequences: any insights?
written by cyril-cros
-
Working With Phastcons Files
written by ancient_learner
-
What Metrics Are Best To Describe The "Coverage" Of Rna-Seq Data?
written by Bio_X2Y
