Using fastq-mcf tool

I am new to use the tool fastq-mcf .

The adaptor sequence I am using for the tool is

>Adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

The first few lines of my fastq file looks like

@J00118:654:HNKGTBBXY:8:1101:23673:1226 1:N:0:ANCACG
AATTCGGGNACACTGTTTACTGACATGTGCAGGCTTATTGTGAAGGACACAACACAGGAATGGCCTCATGGATTAG
+
AAFAFJJJ#JJJJJFJJJJJJJJJJJJJFJJJJJJJJJJFJAJJJFJJJJJJJJJJJJJJJFJFJFFJJJJJJJJ-
@J00118:654:HNKGTBBXY:8:1101:23977:1226 1:N:0:ANCACG
ATTCTATTNACTTAATTTACTTTGCTACCTCCTCCTTTGTCCCTCCCACTCCTGTAACTGATGATATCTTATATAA
+
AAFFFJJJ#JJJJJJJFJJJJJJJJJJJJJJJJJJJJJFJJFJFJJAJJJJJJJ<JJJJJJA<F7JJJJJJJJJJJ
@J00118:654:HNKGTBBXY:8:1101:24302:1226 1:N:0:ANCACG
CTAGATGCNCAGCACATGTTTCACATTATTTTGAATGCATTGTTCATTTACAGTTATCCCTCTTCTAATAGTTATC

The commands I used in the command line is

./fastq-mcf.1 Adaptor.fa "V1_Input-1_L_S1_L008_R1_001.fastq > "filtered.fastq"

The error I am getting is

./fastq-mcf.1: line 1: .": command not found
./fastq-mcf.1: line 2: .TH: command not found
./fastq-mcf.1: line 3: .SH: command not found
Too many input files.

Any help will be useful.

genomics

• 2,868 views • link

written 4.2 years ago by aranyak111 •

I'm sure this has been mentioned to you before (and your post before editing shows you know how to do it), please format code as code wherever it is relevant. Your posts are usually messy walls of text that need cleaning up - you should be able to do a better job with all your experience here.

• 0 views • link

written 4.2 years ago by Ram

1 answer

You're trying to run the manual file ( https://linux.die.net/man/1/intro ) of your tool (fastq-mcf.1), not the executable itself

There must be a file fastq-mcf somewhere.

• 0 views • link

updated 4.2 years ago by Ram

• written 4.2 years ago by Pierre Lindenbaum

I have the whole module installed ExpressionAnalysis/ ea-utils in the cluster yet I have been unable to run the program. the first few lines of the fast-mcf looks like this. i am not sure where I will find the executable file for this part of the pacakge .

.\" DO NOT MODIFY THIS FILE!  It was generated by help2man 1.47.1.
.TH FASTQ-MCF "1" "July 2015" "fastq-mcf 1.1.2" "User Commands"
.SH NAME
fastq-mcf \- ea-utils: detect levels of adapter presence, compute likelihoods and locations of the adapters
.SH SYNOPSIS
.B fastq-mcf
[\fI\,options\/\fR] \fI\,<adapters.fa> <reads.fq> \/\fR[\fI\,mates1.fq \/\fR...]
.SH DESCRIPTION
Version: 1.04.676
.PP
Detects levels of adapter presence, computes likelihoods and
locations (start, end) of the adapters.   Removes the adapter
sequences from the fastq file(s).
.PP
Stats go to stderr, unless \fB\-o\fR is specified.
.PP
Specify \fB\-0\fR to turn off all default settings
.PP
If you specify multiple 'paired\-end' inputs, then a \fB\-o\fR option is
required for each.  IE: \fB\-o\fR read1.clip.q \fB\-o\fR read2.clip.fq
.SH OPTIONS
.TP
\fB\-h\fR
This help
.TP
\fB\-o\fR FIL
Output file (stats to stdout)
.TP
\fB\-s\fR N.N
Log scale for adapter minimum\-length\-match (2.2)
.TP
\fB\-t\fR N
% occurance threshold before adapter clipping (0.25)
.TP
\fB\-m\fR N
Minimum clip length, overrides scaled auto (1)
.TP
\fB\-p\fR N
Maximum adapter difference percentage (10)
.TP
\fB\-l\fR N
Minimum remaining sequence length (19)
.TP
\fB\-L\fR N
Maximum remaining sequence length (none)
.TP
\fB\-D\fR N
Remove duplicate reads : Read_1 has an identical N bases (0)
.TP
\fB\-k\fR N
sKew percentage\-less\-than causing cycle removal (2)
.TP
\fB\-x\fR N
\&'N' (Bad read) percentage causing cycle removal (20)
.TP
\fB\-q\fR N
quality threshold causing base removal (10)
.TP
\fB\-w\fR N
window\-size for quality trimming (1)
.TP
\fB\-H\fR

• 0 views • link

written 4.2 years ago by aranyak111 •

Again, what you're showing is the MANUAL of the tool fastq-mcf.1, not an executable bash script.

• 0 views • link

updated 4.2 years ago by Ram

• written 4.2 years ago by Pierre Lindenbaum

Thanks for all the comments. I have been able to solve the problem by finding the right program execution.

• 0 views • link

written 4.2 years ago by aranyak111 •