Hisat2 aligner problem
Dear All, I am trying to align RNA-seq stranded data with Hisat2 aligner, however the program stuck with no error message nor output sam file. my fastq look like this:
@DD61XKN1:241:C748WACXX:2:1101:1339:1934 1:N:0:TAAGGCGA
NTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCT
+
#1:;DDDFHHGHGGIIDGHGG?HGIEEEDFHB@D0@C;/;EAEEECCCAA
@DD61XKN1:241:C748WACXX:2:1101:1335:1958 1:N:0:TAAGGCGA
NACAAGTACATATATCTACACACACACACACACACACACACACACACACA
+
#1::AA2BCC4A<AECGBI<FBF;@G>GIIFEEFE@GEGIIE?6;BFE;D
@DD61XKN1:241:C748WACXX:2:1101:1294:1958 1:N:0:TAAGGCGA
NGACAGATGAAATACCACGGCAGTGAACTGTGAGGTAACTTCCATTTTTT
and my command line is:
hisat2 -p 8 --dta -x /Volumes/hisat.index/mm10 -1 R1.fastq -2 R2.fastq -S R.sam
my index folder contains:
mm10.rf, mm10.1.ht2, mm10.2.ht2, mm10.3.ht2, mm10.4.ht2, mm10.7.ht2, mm10.8.ht2, mm10.exon, mm10.ss
any idea what could be possibly wrong? many many thanks
• 6,572 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Can you paste the logs from the terminal ?
what do you mean ... i wrote everything that i have from the terminal . the program just cant progress .. you get nothing .. only blinking cursor
And is it running? Can you see if it's using resources using (h)top?
yes .. it is running
https://ibb.co/6FfDGVj
Then you just have to be patient.
i was patient overnight :)
Is this specific of the software, of the dataset or of the index? Try the following:
1) Type hisat2 -h and see if you are able to view the help page
2) Use a different set of reads to align on the same index files, and see if the problem persists.
3) Use your reads and try to align to different index files (even if they are form another species, you just have to test software funcitonality).
thank you so much 1) checked .. the program works fine. 2) checked .. still the same error with different fastq files .. the files are not the problem. .. if you look at the index folder content i do see files from 1-8 except 5&6 ...is this normal or index problem?
In theory you should have all the files, according to the manual. On the manual page you can find link to several prebuilt indexes, which should work.
Alignments to human/mouse genome can take several hours (even with 8 cores) if you have million(s) of reads. Sounds like you are running this job in an interactive mode (blinking cursor, no prompt back) so just be patient. It will finish in time.
it was running overnight for 50 million reads only
This is kind of dependent on hardware you have. As long as you are seeing CPU's in use (and the output file is increasing in size) hang in there :-)
that is the point the output is always zero byte even after 12 hours .. that is why i posted my question here actually
My apologies. We missed this important bit in your original question. In that case you should probably kill the job since this is not going anywhere. The output file should have been instantly made and will keep growing over time.
Have you used this program successfully before on this computer? Is it known to work properly? Has the index been successfully used before?
Hello there,
I am currently having what appears to be the same issue with hisat2. the program hangs and give no stdout or stderr, but with an output .sam file that remains at 0 bytes without ever increasing in size no matter how long I wait.
If you found a solution to this issue i'd be very grateful if you could let me know?
Hi Thomas, there is a problem in the index files for unknown reasons .. the hista2 should produce 8 ".hista2" files but rather generate 6. try to download the prebuild index from hist2 website and it will work back again. good luck
I have the same issue with running hisat-align in a loop (R script). The problem may be about some internal operating mechanism of system() function. I say that because when I was stucked with system(hisat...) for many times, but everything is OK in bash (run hisat-align ... directly). And the strange thing is that there's not any specific rule in when it's stuck.
HISAT 0.1.6, R 4.2.2
Open a new question. R is not meant to be abused as a wrapper caller for bash scripts anyway.