Biostar Beta. Not for public use.
Question: Hisat2 aligner problem
0
Entering edit mode

Dear All, I am trying to align RNA-seq stranded data with Hisat2 aligner, however the program stuck with no error message nor output sam file. my fastq look like this:

@DD61XKN1:241:C748WACXX:2:1101:1339:1934 1:N:0:TAAGGCGA
NTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCT
+
#1:;DDDFHHGHGGIIDGHGG?HGIEEEDFHB@D0@C;/;EAEEECCCAA
@DD61XKN1:241:C748WACXX:2:1101:1335:1958 1:N:0:TAAGGCGA
NACAAGTACATATATCTACACACACACACACACACACACACACACACACA
+
#1::AA2BCC4A<AECGBI<FBF;@G>GIIFEEFE@GEGIIE?6;BFE;D
@DD61XKN1:241:C748WACXX:2:1101:1294:1958 1:N:0:TAAGGCGA
NGACAGATGAAATACCACGGCAGTGAACTGTGAGGTAACTTCCATTTTTT

and my command line is:

hisat2 -p 8 --dta -x /Volumes/hisat.index/mm10  -1 R1.fastq -2 R2.fastq -S R.sam

my index folder contains:

mm10.rf, mm10.1.ht2, mm10.2.ht2, mm10.3.ht2, mm10.4.ht2, mm10.7.ht2, mm10.8.ht2, mm10.exon, mm10.ss

any idea what could be possibly wrong? many many thanks

Entering edit mode
0

however the program stuck with no error

Can you paste the logs from the terminal ?

ADD REPLYlink 9 months ago
Vijay Lakhujani
4.1k
Entering edit mode
0

what do you mean ... i wrote everything that i have from the terminal . the program just cant progress .. you get nothing .. only blinking cursor

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
1

And is it running? Can you see if it's using resources using (h)top?

ADD REPLYlink 9 months ago
WouterDeCoster
39k
Entering edit mode
0

yes .. it is running

https://ibb.co/6FfDGVj

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
0

Then you just have to be patient.

ADD REPLYlink 9 months ago
WouterDeCoster
39k
Entering edit mode
0

i was patient overnight :)

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
0

Is this specific of the software, of the dataset or of the index? Try the following:

1) Type hisat2 -h and see if you are able to view the help page

2) Use a different set of reads to align on the same index files, and see if the problem persists.

3) Use your reads and try to align to different index files (even if they are form another species, you just have to test software funcitonality).

ADD REPLYlink 9 months ago
Fabio Marroni
♦ 2.2k
Entering edit mode
0

thank you so much 1) checked .. the program works fine. 2) checked .. still the same error with different fastq files .. the files are not the problem. .. if you look at the index folder content i do see files from 1-8 except 5&6 ...is this normal or index problem?

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
0

In theory you should have all the files, according to the manual. On the manual page you can find link to several prebuilt indexes, which should work.

ADD REPLYlink 9 months ago
Fabio Marroni
♦ 2.2k
Entering edit mode
0

Alignments to human/mouse genome can take several hours (even with 8 cores) if you have million(s) of reads. Sounds like you are running this job in an interactive mode (blinking cursor, no prompt back) so just be patient. It will finish in time.

ADD REPLYlink 9 months ago
genomax
68k
Entering edit mode
0

it was running overnight for 50 million reads only

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
0

This is kind of dependent on hardware you have. As long as you are seeing CPU's in use (and the output file is increasing in size) hang in there :-)

ADD REPLYlink 9 months ago
genomax
68k
Entering edit mode
0

that is the point the output is always zero byte even after 12 hours .. that is why i posted my question here actually

ADD REPLYlink 9 months ago
ta_awwad
• 210
Entering edit mode
0

nor output sam file

My apologies. We missed this important bit in your original question. In that case you should probably kill the job since this is not going anywhere. The output file should have been instantly made and will keep growing over time.

Have you used this program successfully before on this computer? Is it known to work properly? Has the index been successfully used before?

ADD REPLYlink 9 months ago
genomax
68k

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.0