ACGT101-miR program
How can I use ACGT101-miR program for adapter trimming and filtration on small RNA sequencing data
adapter-trimming
mirna
• 1,758 views
•
link
updated
by
Ram
4.5K
• |
written
by
mahla.krishan
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Bioinformatic analysis of small RNA sequencing data
written by mahla.krishan 0I have high thorough small RNA sequenced data based on ILLUMINA TruSeq. I want to analyse and profiling of Small noncoding RNAs (sRNA/sncRNAs) like**profiling microRNAss, …
-
Small RNA sequencing adapter trimming and alignment query
written by Bhumi 0Hi there, I know it might a naïve question regarding the read alignment. I have a small RNA seq data Fastq files (enriched specifically for …
-
select reference mir from NGS data
written by ystokar 0I have NGS data of small RNA and i would like to validate for select miRNAs using PCR. Can I use the mir-seq data to …
-
Can I use TruSeq2-SE.fa blindly given in Trimmomatic?
written by akshay_ware 3Hi, I am working on small RNA-Seq data analysis, I have query regarding trimmomatic tool which widely used for adapter trimming from reads. In the …
-
fastqc report for degradome reads
written by Sam 15Dear All I have some problem with my degradome data, the company provided me two files, raw reads and mappable reads (trimmed reads without the …
-
how to handle isomIRs in small RNA sequencing analysis
written by hannah 0Hi I am new to small RNA sequencing so apologies if this is a stupid question..! I have data from an experiment where cells were …
-
read trimming for small RNA NGS data
written by ron128 1Hello all. This seems to be a routinely discussed question with many answers around here, however I could not use the answers provided in other …
-
microRNAseq data: is this normal or weird?
written by niu2rseq 9Hello Dear Friends, I am looking at my current miRNAseq data which was prepared with Illumina TruSeq small RNA sequencing kit. One weird thing came …
-
How to remove degraded RNA fragments from my samll RNA sequencing data
written by wang.qiang.prc 0<p>Hi,</p> <p>It is the first time for me to process the small RNA data. After adapter-trimming, quality-filtering, mapping to the reference genome and removing rRNA …
-
Isomir Discovery Or Sequencing Contaminants?
written by Agatha 35<p>Considering the RNA-seq contaminants list:</p> <pre><code>Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA Illumina 5p RNA Adapter GTTCAGAGTTCTACAGTCCGACGATC Illumina RNA Adapter1 TCGTATGCCGTCTTCTGCTTGT Illumina Small RNA 3p Adapter …
Access or installation of there program
What have you tried?
This has been asked and answered previously. where to download proprietary miRNA software This is proprietary software, if you want it you need to contact the vendor and possibly buy a license. Use of proprietary software should be avoided if possible for the sake of reproducible research.