This is a test version of Biostars. For the public version, visit https://www.biostars.org.
microRNAseq data: is this normal or weird?

Hello Dear Friends,

I am looking at my current miRNAseq data which was prepared with Illumina TruSeq small RNA sequencing kit.

One weird thing came to me is, the top abundant sequence reads that are actually around 1/4 of the total reads is:

>mpf_0_x20198538
TCCTGTACTGAGCTGCCCCGAGTTGGAATTCTCGGGTGCCAAGGAACTCC
#                      ^-------------------^

And the second abundant read is actually just one nucleotide shorter:

>mpf_20198538_x18715060
TCCTGTACTGAGCTGCCCCGAGTGGAATTCTCGGGTGCCAAGGAACTCCA
#                     ^-------------------^

After trimming the adapter TGGAATTCTCGGGTGCCAAGG, the sequencing reads indicate that more than 50% of total reads are pointing to one microRNA (miR-486). This definitely is really weird.

Have anyone seen this before? Is this possible in blood samples? Or this might be due to the library prep method? Or I am using the wrong way to look at these reads?

Can anyone give me some comments or hints? Thank you very much!

ngs microrna

1 answer

Trim those adapters and map the remaining sequences to the genome.

As you said 50% of reads map to that mirna, that portion might be slightly more than what one highly expressed mirna would be. If you have replicates that will be useful.

Log in to answer this question.