Hi, guys.
I'm having trouble using cutadapt to trim the raw read(single-end) of small RNA seq.(Illumina TruSeq) I got the index information of the adapter from the sequencing facility. So I tried to trim adapters using cutadapt like below
cutadapt -b TGGAATTCTCGGGTGCCAAGG -b AACTCCAGTCAC"$INDEX_SEQ"ATCTCGTATGCC -O 3 -m 17 -o $trimmed_fastq.gz $fastq.gz
The first adapter is Illumina Samll RNA Adapter and the second one is the adapter information including index(bold 6 bases). But the fastqc report of trimmed read gives me there's TGGAATTCTCGGGTGCCAAGG sequence still over represented~!.
So if I go cutadapt again "-b TGGAATTCTCGGGTGCCAAGG" for $trimmed_fastq.gz, then they are gone. Why doesn't cutadapt get rid of TGGAATTCTCGGGTGCCAAGG at the first time?
I'm asking this because I'm ordered to use cutadapt.... If anybody know what's going on or know how to change the option of cutadapt, please help me..
Thank you
0 answers
No answers yet.
Log in to answer this question.
-
Small RNA Seq Data-Removing Adapters- Illumina GA2 instrument
written by jspe •
-
Which truseq trimmomatic adapters file to use when removing truseq adapters?
written by salamandra
-
Removing Illumina Single End PCR Primers and TruSeq Adapters
written by serpalma.v •
-
RNA-seq adaptor sequence
written by Arindam Ghosh
-
Cutadapt using issue
written by woongjaej •
-
About small RNA adapter trimming
written by Calvin •
-
Should adapters for RNASeq be removed before alignment?
written by ddzhangzz
-
cutadapt: forward and reverse adapter sequence options
written by umn_bist •
-
Protocol of cutadapt
written by gufernandez10 •
-
Cutadapt 5' adapter
written by ashwini
You should be able to see in the log file how many times it found each adapter in each position. Try to compare the two runs.
I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences??
Looks like it. That's weird.
Nothing to say in that case.
Putting
bbduk.shfrom BBMap out there in case you are able to use a different program. Option to use would beliteral=TGGAATTCTCGGGTGCCAAGG,AACTCCAGTCACThank you genomax!
I'll try to compare results from the both. Thank you for your advice