Hello,
Maybe this question is a little naive but I can't find a clear answer online.
I am trying to reproduce a paper which uses a oligo that is meant to hybridize to SARS-CoV-2 genome. When I try to map the possition where this oligo hybridize within the virus genome (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2), I find the exact same sequence that is published in this oligo, but I am supposed to find the reverse complementary sequence (otherwise it wouldn't hybridize).
The only thing I can think is that the sequence published is the cDNA and not the actual RNA genome. (that, or the published sequence is wrong)
The oligo sequence published is AAACCAAATACCTGGTGTATACGTT and I find this exact sequence in position 6275 to 6299.
Edit:
I found out that tje sequence of one ORF (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?from=266&to=21555) starts with an ATG codon (which should be CAT in the case of the cDNA seq). Further, the predicted aminoacid sequence using this ORF as published in this genome is the exact aminoacid sequence of this ORF when translated. Is this enough to say that this is indeed the actual genomic RNA strand?
sequencing
genome
rna
strand