This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to design one PCR primer for 5 different sequences by linux command line ?

Hi every one someone help me please, I need design one PCR primer for 5 different sequences by linux command line, Is there a tool to do that?

Thanks

pcr eprimer3 terminal primer ncbi

thank you, but I need make this by command line on linux terminal

1 answer

rm -f output.txt
for F in input1 input2 input3 input4 input5
do
cat ${F} | primer3_core | grep -E '(PRIMER_(LEFT|RIGHT)_[0-9]+_SEQUENCE)' | cut -d '=' -f 2 -  | paste - - | sort | uniq >> output.txt
done


cat output.txt | sort | uniq -c | awk '$1==5'

Thank you, after use give me

Pick PCR primers and hybridization oligos
Input nucleotide sequence(s): Error: Failed to open filename 'LOCUS       OM432158               29805 bp    RNA     linear   VRL 28-JAN-2022'
Error: Unable to read sequence 'LOCUS       OM432158               29805 bp    RNA     linear   VRL 28-JAN-2022'
Input nucleotide sequence(s): Error: Failed to open filename 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Error: Unable to read sequence 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Died: eprimer32 terminated: Bad value for '-sequence' and no more retries
Pick PCR primers and hybridization oligos
Input nucleotide sequence(s): Error: Failed to open filename '>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome'
Error: Unable to read sequence '>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome'
Input nucleotide sequence(s): Error: Failed to open filename 'ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA'
Error: Unable to read sequence 'ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA'
Died: eprimer32 terminated: Bad value for '-sequence' and no more retries
Pick PCR primers and hybridization oligos
Input nucleotide sequence(s): Error: Failed to open filename 'LOCUS       OL779038               29725 bp    RNA     linear   VRL 09-DEC-2021'
Error: Unable to read sequence 'LOCUS       OL779038               29725 bp    RNA     linear   VRL 09-DEC-2021'
Input nucleotide sequence(s): Error: Failed to open filename 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Error: Unable to read sequence 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Died: eprimer32 terminated: Bad value for '-sequence' and no more retries
Pick PCR primers and hybridization oligos
Input nucleotide sequence(s): Error: Failed to open filename 'LOCUS       OL601549               29762 bp    RNA     linear   VRL 22-NOV-2021'
Error: Unable to read sequence 'LOCUS       OL601549               29762 bp    RNA     linear   VRL 22-NOV-2021'
Input nucleotide sequence(s): Error: Failed to open filename 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Error: Unable to read sequence 'DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate'
Died: eprimer32 terminated: Bad value for '-sequence' and no more retries

Thanks, Pierre Lindenbaum but I used EMBOSS_PRIMER32_CORE =/usr/bin/primer3_core eprimer32 -sequence=

which take sequence fasta file name, don't take sequence, So give me

Pick PCR primers and hybridization oligos
Error: Failed to open filename ''
Error: Unable to read sequence ''
Died: eprimer32 terminated: Bad value for '-sequence' and no prompt

and meaning of this line (grep -E '(PRIMER_(LEFT|RIGHT)_[0-9]+_SEQUENCE)') thanks

Failed to open filename ''

check your syntax

line (grep -E '(PRIMER_(LEFT|RIGHT)_[0-9]+_SEQUENCE)') thanks

peak up all the lines that contains the xx primers

the output of primer3 is something like

PRIMER_LEFT_1_SEQUENCE=AAATATAATATATATATTA
PRIMER_RIGHT_1_SEQUENCE=AAATATAATATATATATTA
PRIMER_LEFT_2_SEQUENCE=AAATATAATATATATATTAA
PRIMER_RIGHT_2_SEQUENCE=AAATATAATATATATATTAA
PRIMER_LEFT_3_SEQUENCE=AAATATAATATATATATTAAT
PRIMER_RIGHT_3_SEQUENCE=AAATATAATATATATATTAAT
(...)

Log in to answer this question.