Python Regular Expression

How can i print the sequence only from embl and gcg file in python by using regular expression pattern ?

this is embl file and this is gcg file

re embl gcg python

• 1,116 views • link

updated 4.6 years ago by seidel

• written 4.6 years ago by Kmh •

This is something that BioPython can do. Is there a reason not to use that?

• 0 views • link

written 4.6 years ago by seidel

0 answers

No answers yet.

More posts like this

Weird insert size distribution plot
written 2.0 years ago by Ankit

Hi everyone, I was trying to do analysis on my sample and observed a weird pattern of insert size distribution. Run is PE: 2X150 The …
Get all isoforms and proteins that correspond to list of Trinity gene IDs
written 3.5 years ago by cdsparks •

Hello, After using TXImport to summarize my transcript abundance to the gene level, and then running DESeq2, I have a large list of genes that …
FAA File Sequence
written 3.6 years ago by Maria Eduarda •

I used this sequence of codes to print the sequences with a header: ![enter image description here][1] but now that I'm trying to print without …
Star indexing
written 3.7 years ago by borna.jurkovic13 •

I've been trying to STAR index a reference sequence file but I am not getting a fa fai file. These are the files I am …
Biased GC content distribution in miRNA Illumina sequencing data
written 4.2 years ago by madhuratathode •

Hi All, I am working on small RNA (miRNA) sequencing data analysis of human Glioblastoma cell line. I am checking the fastqc analysis results for …
Extracting list of mutations from .tsv file and arrange them in protein specific with binary 0 (Abs…
written 4.3 years ago by k.kathirvel93

Dear All, I have .tsv file like this with genome name (1st coloumn) and aminoacid mutations for different proteins... ![enter image description here][1] I want …
Identification of Gene through GEN SCAN
written 4.7 years ago by anasjamshed

I am using GENSCAN to predict the gene from nucleotide sequence: ![Output][1] [1]: /media/images/ed578a79-dc9f-49e0-a24d-3599cd6e I am also using python side by side to merge exons …
GSEA error 1005
written 5.1 years ago by komalkharat12345 •

Hello I am trying to analyze human gene sets for their expression in tumor. I am facing an error saying "The collapsed dataset was empty …
Why my regular expression fails to match all the reasonable seq?
written 9.6 years ago by jinkuozhang •

I try to find all the possible "N20NGG" sequence in a target sequnce like: > example_seq ATTAATACTTTTAACAATTGTAGTATATAAAAAAGGGAGTAACCGAAAACGGTCGGGACCGAAAACGG What I used is python regular expression: import …
Regular expression matching with Python and biopython SeqIO
written 11.7 years ago by Ian

After many years of using Perl I am starting to learn Python. As an example I want to perform regular expression matching in sequences extracted …