Python Regular Expression

How can i print the sequence only from embl and gcg file in python by using regular expression pattern ?

this is embl file and this is gcg file

re embl gcg python

• 1,120 views • link

updated 4.7 years ago by seidel 1.1K • | written 4.7 years ago by Kmh 0

This is something that BioPython can do. Is there a reason not to use that?

• 0 views • link

written 4.7 years ago by seidel 1.1K

0 answers

No answers yet.

More posts like this

Editing seurat object metatdata
written 2.3 years ago by Happiness 0

I have a Seurat object called `test_seurat` and I would like to sort this object based on the pseudotime which is a column title `p3.pseudotime`. …
Get all isoforms and proteins that correspond to list of Trinity gene IDs
written 3.7 years ago by cdsparks 0

Hello, After using TXImport to summarize my transcript abundance to the gene level, and then running DESeq2, I have a large list of genes that …
FAA File Sequence
written 3.7 years ago by Maria Eduarda 0

I used this sequence of codes to print the sequences with a header: ![enter image description here][1] but now that I'm trying to print without …
Star indexing
written 3.8 years ago by borna.jurkovic13 0

I've been trying to STAR index a reference sequence file but I am not getting a fa fai file. These are the files I am …
Biased GC content distribution in miRNA Illumina sequencing data
written 4.3 years ago by madhuratathode 0

Hi All, I am working on small RNA (miRNA) sequencing data analysis of human Glioblastoma cell line. I am checking the fastqc analysis results for …
Identification of Gene through GEN SCAN
written 4.8 years ago by anasjamshed 14

I am using GENSCAN to predict the gene from nucleotide sequence: ![Output][1] [1]: /media/images/ed578a79-dc9f-49e0-a24d-3599cd6e I am also using python side by side to merge exons …
GSEA error 1005
written 5.2 years ago by komalkharat12345 0

Hello I am trying to analyze human gene sets for their expression in tumor. I am facing an error saying "The collapsed dataset was empty …
HMM in Python
written 5.2 years ago by anasjamshed 14

The following figure shows an HMM with two states a and b. When HMM is in the state a, it is more likely to emit …
Why my regular expression fails to match all the reasonable seq?
written 9.7 years ago by jinkuozhang 3

I try to find all the possible "N20NGG" sequence in a target sequnce like: > example_seq ATTAATACTTTTAACAATTGTAGTATATAAAAAAGGGAGTAACCGAAAACGGTCGGGACCGAAAACGG What I used is python regular expression: import …
Regular expression matching with Python and biopython SeqIO
written 11.8 years ago by Ian 614

After many years of using Perl I am starting to learn Python. As an example I want to perform regular expression matching in sequences extracted …