This is a test version of Biostars. For the public version, visit https://www.biostars.org.
NGS raw data manipulation using Linux/Unix

Hi,

I wanna add sample ID along with read IDs in my NGS data using unix platform. Can anyone help me with this?

Thanks in advance

Rijith Jayarajan

datamanipulation
• 1,968 views • link
updated by 5heikki 5heikki • written by rijithraj • rijithraj

add sample ID along with read IDs

Add exactly where? If in fastq header, that would break the Illumina sequence identifier format.

• 0 views • link
written by GenoMax GenoMax

If you go from:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

to:

@SEQ_ID;SAMPLE_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

How would that break the header format?

• 0 views • link
written by 5heikki 5heikki

I mostly deal with Ion Torrent reads. Are there any programs that would stop working properly if Illumina read headers were modified by the user?

• 0 views • link
written by 5heikki 5heikki

1 answer

This is...uncommon. Usually each fastq files name indicates its sample name, or you can add sample ID to the read group info in a bam, but for many applications, again, the sample name can be indicated in the bam name.

• 0 views • link
written by swbarnes2 swbarnes2

Log in to answer this question.

More posts like this