This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Where to find ERR samples information ?

Hi, Please help me with finding the sample info like read length and platform used in ERR188337 for example ?

Thanks

rna-seq
• 2,237 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by XBria XBria

If an answer was helpful you should upvote it, if the answer resolved your question you should mark it as accepted. Upvote|Bookmark|Accept

• 0 views • link
written by WouterDeCoster WouterDeCoster

2 answers

search SRA: https://www.ncbi.nlm.nih.gov/sra/?term=ERR188337

https://trace.ncbi.nlm.nih.gov/Traces/sra/?run=ERR188337

ILLUMINA (Illumina HiSeq 2000) , paired-end, 75 bp

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thank you :) very immediate help Can you please the above comment I made, and let me know where 75 bp is written ?

• 0 views • link
written by XBria XBria

I've looked at the "Reads" tab in https://trace.ncbi.nlm.nih.gov/Traces/sra/?run=ERR188337

>gnl|SRA|ERR188337.1.1 HWI-ST661:131:C051TACXX:2:1101:1192:2142 (Biological)
NGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGCCGCAGATGATGG
AAGGGAACGGGAACN
>gnl|SRA|ERR188337.1.2 HWI-ST661:131:C051TACXX:2:1101:1192:2142 (Biological)
TGTCTCACTGCCTTTTTCTTTCTTCTTTTTTTGTTTCTTTTTCTTCTTTTTGGCTCCAGT
GTCATTGGCTGNNNN
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

You realize you can just count the number of nucleotides to get the read length, right?

• 0 views • link
written by WouterDeCoster WouterDeCoster

I 've read on wikipedia the first line of a fastq file contains read length, I can find the readlength in SRA though.

• 0 views • link
written by XBria XBria

Not normally. SRA may include that as a post-processed result. They also change the original Illumina identifiers (though you can recover the originals by using -F option during fastq-dump).

• 0 views • link
written by GenoMax GenoMax

You can always back-reference to the relevant ENA page, which usually contains the platform. You can usually infer the approximate read length from the platform. Or download it and run it through FastQC or the such. The ENA search function was how I found that page.

• 0 views • link
written by jared.andrews07 jared.andrews07

Dear Jared,

I open the fastq file and see the following:

@ERR188044.9 HWI-ST457:201:C0EWEACXX:1:1101:2976:1993/1
CAAGTTCTTTCCTTCCCTGCCAGCCAGATAGATAGACAGATGGGAAAGGCAGGCGCGGCCTTCGTTGTCAGTAGTT
+
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJIIHDDAECD?CC@CDDCDC>>
@ERR188044.35 HWI-ST457:201:C0EWEACXX:1:1101:8799:1991/1
CCACTGCCGAGAATGCTAGGCTTCTGGCCCAGAAAAGAGGAGCTTTGCAGGGCTCTGCATGGCAGGTTAGCTCAGA
+
CCCFFFFFHGHGHIJJJIJJJJJJIIJJJJJJJJJJJJJJJIJJJIJFIJIIIIIJJHHHHHFFFD;>C@CCDDD@
@ERR188044.92 HWI-ST457:201:C0EWEACXX:1:1101:19896:1985/1
GGCGAATCGTAATGAGGCGTGCGCCGCCAATATGCACTGTACATTCCACAAGCATTGCCTTCTTATTTTACTTCTT
+
CCCFFFFFHHHHHJJJJIJEHGGGHIIJJJJIJJJJIJJHGHHHHHHGFFFFFEEEEEEDDDDDDDEEEEDDCCDA
@ERR188044.120 HWI-ST457:201:C0EWEACXX:1:1101:1538:2090/1
CGGCAGTGATCACACGTCGGCTGCTGGGAAGATCTGGATTCTCGTTTCAGGTCACCATCAGAAAAGCTAAGTTTGC
+

is the readlength 201 ? Am I right ?

• 0 views • link
updated by GenoMax GenoMax • written by XBria XBria

Where do you see 201? It is 76 bp.

• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this