This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to filter reads only with single SNV

Hi all,

I'd like to know whether there are any tools to filter out only reads with a single SNV/mutation.

In detail, I generated a randomly mutated library of a protein-coding gene, screened non-functional variants, and then sequenced their CDS region. Unfortunately, many of the reads have multiple mutations at once so it's hard for me to find which mutation is critical for the loss-of-function. So I'd like to use reads only with a single mutation/SNV compared to the reference sequence for my variant calling.

For example,

reference:   actgggtacccattgactagataccgta
read 1:      actgggtCcccattgactagataccgta   <- read I want to get (read with a single mutation)
read 2:      actgggtacGcattgactaTataccgta  <- read I don't want to use (read with more than one mutation)

I'd appreciate it a lot if you give me any advice on this. Thank you!

filtering_reads snv amplicon_sequencing snp

2 answers

filter with edit-distance NM==1

samtools view -e '[NM]==1'

Oh, I found the command:

samtools calmd -e  input.sam reference.fa | awk '$1 ~ "^@" || $13 ~ ":1$"'  | samtools view -b - > output.sam

$13: NM

Thanks for your advice, Pierre!!

sunhyunchang : You need to upgrade to latest version of samtools which is 1.12 as of today. This version introduced the option that @Pierre mentions above.

At the read level, single base deviations from the reference are likely to be errors, not real SNPs.

Log in to answer this question.