I have several large regions (100 - 300 kb) of sequence data that I would like to BLAST against the human genome (HG19). I understand that due to memory limitations, it might be necessary to split these query sequences into smaller pieces. What I am having difficulty with is parsing/combining the output of a BLAST search using such a split query. Does anyone know of a tool that would be reasonably easy to implement or a script (preferably using Biopython) that could be modified to perform such a task? From my search so far, I have found FragBlast (http://www.clarkfrancis.com/blast/fragblast.html), which will only allow one sequence in the database (thus, I would need to blast each chromosome separately), and PowerBLAST (http://genome.cshlp.org/content/7/6/649.full#), which does not appear to have been maintained.
Thank you for your help!
1 answer
I tried to implement a program to do this. See: https://github.com/lindenb/jvarkit/wiki/MergeSplittedBlast
I didn't test it much, use with care, don't trust the scores,E-value, etc...
Example input
http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>BLASTN 2.2.28+</BlastOutput_version>
<BlastOutput_reference>Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14.</BlastOutput_reference>
<BlastOutput_db>database.fa</BlastOutput_db>
<BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
<BlastOutput_query-def>q1</BlastOutput_query-def>
<BlastOutput_query-len>123</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-2</Parameters_sc-mismatch>
<Parameters_gap-open>0</Parameters_gap-open>
<Parameters_gap-extend>0</Parameters_gap-extend>
<Parameters_filter>m;</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_query-ID>Query_1</Iteration_query-ID>
<Iteration_query-def>q1</Iteration_query-def>
<Iteration_query-len>123</Iteration_query-len>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gnl|BL_ORD_ID|3</Hit_id>
<Hit_def>chrM:196-273:16571</Hit_def>
<Hit_accession>3</Hit_accession>
<Hit_len>77</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>143.312</Hsp_bit-score>
<Hsp_score>77</Hsp_score>
<Hsp_evalue>1.29152e-37</Hsp_evalue>
<Hsp_query-from>31</Hsp_query-from>
<Hsp_query-to>107</Hsp_query-to>
<Hsp_hit-from>1</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>77</Hsp_identity>
<Hsp_positive>77</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>77</Hsp_align-len>
<Hsp_qseq>TACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACA</Hsp_qseq>
<Hsp_hseq>TACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACA</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>2</Hit_num>
<Hit_id>gnl|BL_ORD_ID|2</Hit_id>
<Hit_def>chrM:131-208:16571</Hit_def>
<Hit_accession>2</Hit_accession>
<Hit_len>77</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>78.6796</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>3.69397e-18</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>42</Hsp_query-to>
<Hsp_hit-from>36</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>42</Hsp_identity>
<Hsp_positive>42</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>42</Hsp_align-len>
<Hsp_qseq>CCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTGTG</Hsp_qseq>
<Hsp_hseq>CCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTGTG</Hsp_hseq>
<Hsp_midline>||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>3</Hit_num>
<Hit_id>gnl|BL_ORD_ID|4</Hit_id>
<Hit_def>chrM:261-338:16571</Hit_def>
<Hit_accession>4</Hit_accession>
<Hit_len>77</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>52.8265</Hsp_bit-score>
<Hsp_score>28</Hsp_score>
<Hsp_evalue>2.23898e-10</Hsp_evalue>
<Hsp_query-from>96</Hsp_query-from>
<Hsp_query-to>123</Hsp_query-to>
<Hsp_hit-from>1</Hsp_hit-from>
<Hsp_hit-to>28</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>28</Hsp_identity>
<Hsp_positive>28</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>28</Hsp_align-len>
<Hsp_qseq>CCGCTTTCCACACAGACATCATAACAAA</Hsp_qseq>
<Hsp_hseq>CCGCTTTCCACACAGACATCATAACAAA</Hsp_hseq>
<Hsp_midline>||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
</Iteration_hits>
<Iteration_stat>
<Statistics>
<Statistics_db-num>254</Statistics_db-num>
<Statistics_db-len>19558</Statistics_db-len>
<Statistics_hsp-len>13</Statistics_hsp-len>
<Statistics_eff-space>1788160</Statistics_eff-space>
<Statistics_kappa>0.46</Statistics_kappa>
<Statistics_lambda>1.28</Statistics_lambda>
<Statistics_entropy>0.85</Statistics_entropy>
</Statistics>
</Iteration_stat>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>
running the program:
$ java -jar dist/mergesplittedblast.jar blast.xml |\
xmllint --format -
output:
http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>BLASTN 2.2.28+</BlastOutput_version>
<BlastOutput_reference>Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14.</BlastOutput_reference>
<BlastOutput_db>database.fa</BlastOutput_db>
<BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
<BlastOutput_query-def>q1</BlastOutput_query-def>
<BlastOutput_query-len>123</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-2</Parameters_sc-mismatch>
<Parameters_gap-open>0</Parameters_gap-open>
<Parameters_gap-extend>0</Parameters_gap-extend>
<Parameters_filter>m;</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_query-ID>Query_1</Iteration_query-ID>
<Iteration_query-def>q1</Iteration_query-def>
<Iteration_query-len>123</Iteration_query-len>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gnl|BL_ORD_ID|3</Hit_id>
<Hit_def>chrM</Hit_def>
<Hit_accession>3</Hit_accession>
<Hit_len>16571</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>78.6796</Hsp_bit-score>
<Hsp_score>123</Hsp_score>
<Hsp_evalue>3.69397e-18</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>123</Hsp_query-to>
<Hsp_hit-from>166</Hsp_hit-from>
<Hsp_hit-to>288</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>42</Hsp_identity>
<Hsp_positive>42</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>123</Hsp_align-len>
<Hsp_qseq>CCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAA</Hsp_qseq>
<Hsp_hseq>CCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAA</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
</Iteration_hits>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>
Log in to answer this question.
Similar issue: BLAST+ query splitting/chopping in BLASTXML format