This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Modify Contig Format:

Hi everyone I need co change a contig file format : can any one help me out using awk or perl

Input file:

>NODE_411_length_76_cov_325.381_ID_5152754
AAGAAGCAAATAtAAACAGCATTAAAGATATACACATAAAAATGAAGTACTAAA
>NODE_412_length_75_cov_54.1_ID_5146650
CCCTAAATTGAGAAAATAACTTTAGGGAATATATCAATGTACAGTGCCCGCTTCGTTAT
>NODE_413_length_74_cov_63.8947_ID_373286
GTATTGATCCAAAATCGGTGTAAATATTACCCTTTTTAGGTGTATTAGGTGTTAAATGTA

Out put should be like : 

>Contig0.1
AAGAAGCAAATtAtAAACtAGCATTAAAGATATACACATAAAAATGAAGTACTAAA    
>Contig0.2
CCCTAAATTGAGAAAAaTAACTTTAGGGAATATATCAATGTACAGTGCCCGCTTCGTTAT
>Contig0.3
GTATTGATCCAAAATCGGTGTAAATATTACCCTTTTTAGGTGTATTAGGTGTTAAATGTA

Thank you advance .

perl awk fasta
• 2,747 views • link
updated by Kenosis Kenosis • written by HG HG

Your output format is awkward, why would you want that? It's not even fasta format because of the extra whitespace before >. What do you need the extra line break for? Please be more specific about what you want to change, as your examples do not match each other.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Do you just need the names ("NODE_411...", etc.) changed or is something supposed to be done with the sequences as well? How are we to know what bases should be made lower case or is that already done? I have a feeling that you don't actually know what you would like to do (you're certainly not providing enough information for anyone to help you).

• 0 views • link
written by Devon Ryan Devon Ryan

Hello, i have modify the above question please have a look.

• 0 views • link
written by HG HG

2 answers

Given the update:

awk 'BEGIN{i=1; OFS=""}{if(substr($0,1,1) == ">") { print ">Contig0.",i; i+=1}else{print $0}}' foo.fa
• 147 views • link
written by Devon Ryan Devon Ryan

Thank you so much . Its working fine.

• 0 views • link
written by HG HG

Another awk option:

awk '{/^>/ && sub(/>.+/,">Contig0."++i); print}' foo.fa
• 203 views • link
written by Kenosis Kenosis

Nice, that's rather more concise than mine!

• 0 views • link
written by Devon Ryan Devon Ryan

With Perl:

perl -lne 's/^>.+/">Contig0.".++$i/e;print' foo.fa
• 161 views • link
written by Kenosis Kenosis

Log in to answer this question.

More posts like this
  • Problem With Perl Script When Extracting Sequences According To The Ids
    written by biolab biolab
    <p>Dear All,</p> <p>I have a <strong>Fasta file</strong> and a <strong>List file</strong>. I need to extract sequences according to the IDs in each line of the …
  • Error In Batch Mode Run Prodigle
    written by HG HG
    <p>Hi Everyone i am trying to run prodigal in batch mode for 50genome. I want after each run the two out put file name according …
  • Error In Batch Mode Run Prodigle
    written by HG HG
    <p>Hi Everyone i am trying to run prodigal in batch mode for 50genome. I want after each run the two out put file name according …
  • Why Perl Or Sed Command Not Working
    written by biolab biolab
    <p>Hi everyone I have a fasta file like below.</p> <pre><code>&gt;miR156a GACAGAA &gt;miR156b GACAGAA &gt;miR156c GACAGAA ............ </code></pre> <p>I need to format it as below.</p> <pre><code> …
  • How To Determine Whether Proteins Are Contained In Assembled Contigs
    written by HG HG
    <p>Hi everyone, I want to check <strong>whether proteins are contained in assembled contigs or not</strong> ? </p> <p>For this After De-novo assembly I made a …
  • How To Edit Contig Format??
    written by HG HG
    <p>Hi I have some contig like that :</p> <pre><code> &gt;NODE_1_length_262931_cov_39.3702_ID_6774944 GACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGT GAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTG ACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCAC CTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGTAAGGAAGGGGCAACA &gt;NODE_2_length_249731_cov_38.5539_ID_6775452 TGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGC TGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCA TTACCAACATCGTGAAAGAAATCCACAATAATGATCTTAAGCAGCAATTGATGAGTGAAT ..................................................................................................................... </code></pre> <p>I Need like this each …
  • Opera Scaffolding Error: Reads In The Wrong Orientation
    written by HG HG
    <p>Hi everyone I am using Opera for Scaffolding with mapping tool <a href='http://bio-bwa.sourceforge.net/'>bwa</a> . I am getting an error : Please help me out</p> <p>I …
  • Opera Scaffolding Error: Reads In The Wrong Orientation
    written by HG HG
    <p>Hi everyone I am using Opera for Scaffolding with mapping tool <a href='http://bio-bwa.sourceforge.net/'>bwa</a> but I am getting an error : Please help me out</p> <p>I …
  • Taking Out Specific Columns From An Alignment
    written by figo figo
    <p>Hi All,</p> <p>I wanted to write a script to remove certain columns which are in array from an alignment fasta file. I wrote a perl …
  • How To Calculate The Coverage Of A Specific Interval Based On Data From A Bam File
    written by rehma.ar • rehma.ar
    <p>Dear All!</p> <p>i want to calculate the coverage of a specific fragment from a bam file. i am using this script right now</p> <pre><code>samtools view …