Hi :)

I've been running BLASTs of short sequencing reads against a custom genome. Is there any way I can automatically tally up the number of times an identical/very-similiar sequence read appears?

For example:

GAGACGACGAGAGCAGCGAGCTAGAGCGACAGGCAAATTAA

If the sequence in italics is from genome region A and the sequence in bold is from genome region B - and this sequence appears 21 times within my sequence reads - is there a way I can use BLAST to automatically tabulate/tally that it does appear this many times?

Thank you!