Tallying Multiple Hits From Blast Results
Hi :)
I've been running BLASTs of short sequencing reads against a custom genome. Is there any way I can automatically tally up the number of times an identical/very-similiar sequence read appears?
For example:
GAGACGACGAGAGCAGCGAGCTAGAGCGACAGGCAAATTAA
If the sequence in italics is from genome region A and the sequence in bold is from genome region B - and this sequence appears 21 times within my sequence reads - is there a way I can use BLAST to automatically tabulate/tally that it does appear this many times?
Thank you!
• 523 views
•
link
0 answers
No answers yet.
Log in to answer this question.
do you 'know' the sequence or do you want to find all the repeats ?
I do know the sequences in-theory however I have over 9500 possible combinations of 2 sequences being together.
cross posted on http://seqanswers.com/forums/showthread.php?t=34967