Here is an example of RNAplot's input format:

>seq1
ACTGAGCTTAGCGATTAGGC
(((..((((...)))).)))

This format is known as "dot-bracket notation", and it is used to represent a RNA secundary structure by many other packages, and is also used by many Vienna scripts. I can not find much documentation online, but here there is some.

Note that you can calculate this structure by using the RNAfold tool:

$: echo ">seq1" > myseq.txt
$: echo "ACTGAGCTTAGCGATTAGGC" >> myseq.txt
$: cat myseq.txt
>seq1
ACTGAGCTTAGCGATTAGGC

$: cat myseq.txt | RNAfold > myfold.txt
$: cat myfold.txt
>seq1
ACUGAGCUUAGCGAUUAGGC
.....(((((.....))))) ( -2.70)

# Note: to use RNAplot, you have to remove the score first:
$: sed -i 's/ \(.*\)$//' myfold.txt
$: cat myfold.txt
>seq1
ACUGAGCUUAGCGAUUAGGC
.....(((((.....)))))

Once you have the input file, you can produce the plot by simply calling RNAplot:

cat myfold.txt | RNAplot -o svg

http://www.tbi.univie.ac.at/~ronny/RNA/RNAplot.html

RNAplot 2.1.1

Draw RNA Secondary Structures

The program reads RNA sequences and structures from stdin in the format as produced by RNAfold and produces drawings of the secondary structure graph.