This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Input format for RNAfold

Hi all,

I'm using RNAfold command (Vienna package) to draw RNA secondary structure starting from 2 sequences:

  • first one is a mRna sequence (for example: "ACUGAGCUUA");
  • second one is a miRna sequence (for example: "GCGAUUAGGC");

RNAfold reference says input type is a single line sequence, something like "CGACGTAGATGCTAGCTGACTCGATGC".

My question is: I need to build a unique string joining "ACUGAGCUUA" + "GCGAUUAGGC" in "ACUGAGCUUAGCGAUUAGGC" before I send input data?

Thanks in advance!

rnafold

It sounds like you're not trying to fold anything, but see if the miRNA sequence might target the mRNA fragment. RNAfold is meant for single stranded RNA folding.

Thanks for your answer, i use two sequences i know they match perfectly, because they come from another software used to predict matching. I can use RNAfold anyway?

Sure, but to what end? If the prediction software didn't provide the predicted base pairing and that's what you need then you could just link the two sequences by 5 or so Ns, which should provide a sufficient hairpin sequence.

I try to explain better my problem: I'm using a prediction software, by which I can obtain correct paring, but I don't have a tool to draw secondary structure, so my coworker suggests me use RNAfold (or RNAplot, the same, because I need only the ps file). I'm on the right way?

P.s.: I'm sorry for my (bad) English... :(

I imagine the RNAduplex command would be more useful then.

Just seen RNAduplex reference, but it seems there isn't any way to draw the secondary structure. I need a ps/jpeg/png/svg (or something else) file output file with it.

Then use RNAcofold. You should be able to look through the ViennaRNA documentation for other options.

RNAcofold seems to be better. I'll try and... cross the fingers for me :D

Thanks a lot!

1 answer

Sir, Can you please help me? I have to find the target site of miRNA on specific mRNA. But I m not able to get all data from MirTarBase web server. So how to find the correct target site and also I have to find the miRNA-mRNA bracketed data from RNAfold web server. Please help me to find all these data.

Log in to answer this question.