Get The Dna Sequence From The Human Genome

I have hundreds of genomic coordinates that I want to retrieve their dna sequences in the human genome. e.g. chr1 11355 11391 +

Is there a standard way to get the dna sequence in the human genome. Note that I have the hg19 pre-built index but I'm not sure how to use it.

Thanks,

deleted-post

• 222 views • link

updated 13.5 years ago by KCC

• written 13.5 years ago by ftp

1 answer

Perhaps there is a more slick human-genome specific way to do this. However, using the bedtools function, fastaFromBED

fastaFromBED -fi hg19.fa -bed input.bed -fo output.fa

It's quite fast.

• 0 views • link

written 13.5 years ago by KCC

More posts like this

Obtain genome coordinates for a DNA sequence using ENSEMBL API
written 1.4 years ago by Ishan •

I can successfully use Ensembl BLAT to identify the coordinates in hg38 human genome e.g. for sequence: ACTCACCTCTTGCCAGTGAC However I have many hundreds of sequences …
How to find genomic position
written 4.8 years ago by suxxa •

Hi! I'm wondering how to retrieve, from a given circRNA ( e.g. hsa_circRNA_405987), the genomic position in human genome 19 coordinates ( e.g. 121765368) using …
Retrieve genomic physical coordinates of 3'UTR for set of genes
written 6.6 years ago by Mr Locuace

Hello, I have a list of human genes and I'd like to retrieve the physical coordinates (GRCh37/hg19 assembly) of their 3'UTRs. Are you aware of …
From genomic coordinate to Reference base
written 11.5 years ago by Nicola Casiraghi

Hi, I have an extensive set of genomic coordinates (i.e. chr1:9071988) and I need to automatically get the reference (Human Genome hg19 ) base corresponding …
Map genomic location to human genome
written 11.6 years ago by MAPK

Hi everyone, I have some genomic and transcript sequences. I need to map these sequences to hg19 and get their coordinates in the genome. What …
Shorter Sequences In The Human Genomic Dna Download From Ucsc Genomic Browser Website
written 12.4 years ago by nadarajanvelu •

Hi, I have downloaded the human genomic DNA from the UCSC genomic browser website from the link, hg38.chromFa.tar.gz . When I extracted, I got all …
How To Get Sequence Around Blast Result?
written 13.5 years ago by dustar1986

Hi, I blasted a serires of inquiry sequences against the a pre-built blast-database file using blastall and the xml result was parsed by biopython. I …
Chromosome Position From Ucsc Genome Browser
written 13.9 years ago by Gjain

Hi all, I am looking for the coordinates of all the chromosomes in a particular species from ucsc genome browser. for example, in HG19: …
How To Fetch Sequence From Chromosome Coordinates
written 13.9 years ago by monukmr98

Hi all I have chromosome coordinates (e.g. 5233922 to 5235189 of chr18). how can I get the sequence corresponding to this region ? Like this …
How To Extract Specific Coordinates From Multifasta File
written 15.4 years ago by Florianino •

Hi, I have a genome file in multifasta format <pre><code>>chr1 ATATATACCGA >chr2 TGGCGTATTAT </code></pre> ... and I would like to extract specific coordinates from specific …