Obtain genome coordinates for a DNA sequence using ENSEMBL API
I can successfully use Ensembl BLAT to identify the coordinates in hg38 human genome e.g. for sequence: ACTCACCTCTTGCCAGTGAC
However I have many hundreds of sequences where I need to identify the coordinates and I wanted to use an API to do this. Is there anyway to get the genomic coordinates for short DNA segments such as above?
1 answer
If you are using linux (and are not from a for-profit or industrial institution) you can set up gfServer/gfclient locally to do multiple blat searches.
https://genome.ucsc.edu/FAQ/FAQblat.html#blat3
https://genome.ucsc.edu/FAQ/FAQblat.html#blat11
Log in to answer this question.
More posts like this
-
Retrieving Chromosome Accession for Specific Gene Using Ensembl REST API
written by Nicolas •
-
Is hg38 on the multiz 30-way alignment inaccurate?
written by Daniel •
-
How to obtain genomic coordinates of novel transcripts?
written by nattzy94 •
-
Compara API of Ensembl
written by jrxu.bioinf •
-
Mapping DEXseq exons back to genomic DNA sequences
written by htyu1lmzta •
-
BLAT and Get DNA queries automation
written by guywie •
-
News: Upcoming Workshop: Ensembl Perl APIs
written by Denise CS
-
Shorter Sequences In The Human Genomic Dna Download From Ucsc Genomic Browser Website
written by nadarajanvelu •
-
Get The Dna Sequence From The Human Genome
written by ftp
-
Positioning A Set Of ~20 Bases Dna Sequences
written by Genotepes
