This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Turn Off Blast Search On Reverse Complement Strand In Blastn

I have a quick question:

How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!

blast sequence
• 60,968 views • link
updated by Ram Ram • written by Zhaorong Zhaorong

I think you should someone take care of the target or subject strandedness as well. You should post - filter the results based on the alignment location I guess in query and subject/ target

• 0 views • link
written by jayeshkumarsundaram • jayeshkumarsundaram

3 answers

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
• 15 views • link
updated by Ram Ram • written by Istvan Albert Istvan Albert

In NCBI BLAST+ this is controlled by the '-strand' option.

• 70 views • link
written by Hamish Hamish

For BLAST+, it's -strand {both,plus,minus}

• 201 views • link
written by kevin.l.neff • kevin.l.neff

I'm not sure this option even works because it's giving me identical results for plus and minus.

• 0 views • link
written by kevin.l.neff • kevin.l.neff

hello this is great

• 0 views • link
written by yasopi9568 • yasopi9568

Log in to answer this question.

More posts like this