R or Python package orientation for horizontal colinearity representation

I am looking for an R or Python package dedicated to the representation of simple colinearity between two assemblies basepairs. Please find attached an example of the output I would like to do. Thank you in advance. Outputlink

assembly

• 1,190 views • link

written 5.6 years ago by angez9914 •

Dear Joe,

Thanks a lot.

• 0 views • link

written 5.6 years ago by angez9914 •

1 answer

Check out:

Chromatiblock
Silbelia
Multigeneblast
cblaster and clinker

• 0 views • link

written 5.6 years ago by Joe

More posts like this

How to visualize shared pathways between ORA (enrichment) results?
written 1.7 years ago by Picasa

Hi, I performed an over-representation analysis (ORA) separately for my differentially expressed genes, dividing them into upregulated and downregulated genes. Since I have two datasets, …
Tool: pyGenomeViz - A genome visualization python package for comparative genomics
written 3.0 years ago by moshi •

[pyGenomeViz](https://github.com/moshi4/pyGenomeViz) is a genome visualization python package for comparative genomics implemented based on matplotlib. This package is developed for the purpose of easily and beautifully …
Genetic matrix to STRUCTURE file
written 4.1 years ago by akoontz11 •

I want to convert a genetic matrix (rows are samples, columns are alleles) into a STRUCTURE file (output .str) within R. Is there a preferred …
AFD plot for each VCF file
written 4.6 years ago by anasjamshed

I have 2 test directories: ![dir][1] and one tsv file that contains information about the population: ![pop][2] [1]: /media/images/453029d7-d7c4-4c3a-8334-e117fd3d [2]: /media/images/00802d58-b802-4145-a81a-82d03c99 I want to write …
How to calculate foldchange for log2'd expression data?
written 5.9 years ago by SupBioInformatics •

Hi, I have a math question. I am doing differential expression test. My expression data is already log2'd. I would like to perform t-test between …
Sequence identity between sequences with different lengths
written 7.5 years ago by ricardoguerreiro2121

Hello, A simple question. What is the sequence identity between 2 sequences when one is much larger than the other? Example: seq1: -------------------AGTGTGAAAAAGGT---------------- seq2: ATATATGCGCATGGTAATAAGTGTGAAAAAGGTTATATGCGCATAAGGT …
parse xml proteinpredict files
written 8.6 years ago by Biojl

Hi, I have several thousands of xml files from https://www.predictprotein.org/ calculations for different proteins. I was wondering if anyone knows a package to parse that …
invalid class NChannelSet object: featureNames differ between assayData and featureData
written 9.5 years ago by thyleal

everyone. I'm analyzing a two-channel microarray following an example from Bioconductor Case Studies book. I'm stuck in this error: invalid class “NChannelSet” object: featureNames differ …
Cannot find example_MeQA.R file anywhere.
written 9.9 years ago by lakhujanivijay

Hi, I am trying to test [MeQA][1] pipeline for MEDIP-seq data analysis and I am looking at this link: http://life.tongji.edu.cn/meqa/demo.htm **It says**: Note: If you …
Mapping HGNC ID to uniprot ID
written 11.1 years ago by Paul

I have a list of **HGNC IDs** and wanted to map it to **uniprot.swissprot ID.** The tools I have used so far are - **David …