This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Biopython Translate With N In The Sequence

Hi. I have the following sequence:

CAGGTGCAGCTGGTGCAGAGCGGCAGCGAGCTGAAGAAACCTGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACGCCATGAACTGGGTCCGCCAGGCCCCAGGCCAGGGACTGGAATGGATGGGCTGGATCAACACCAACACCGGCAACCCCACCTACGCCCAGGGCTTCACCGGCAGATTCGTGTTCAGCTTCGACACCAGCGTGTCCACCGCCTACCTGCAGATCTGTAGCCTGAAGGCCGAGGACACCGCCGTGTATTNNTGTGCGA

There are a couple of N's in there. I would like to use biopython's translate function on the seuqence, but this throws the following error: "Codon TNN is invalid"

Is there a way to get this function to return a default amino acid such as 'X' when the translation is unsuccessful? Any ideas?

biopython
• 4,660 views • link
updated by Geparada Geparada • written by Richard Richard

1 answer

I don't have any problem to translate your sequence using biopyhton

>>> from Bio.Seq import Seq
>>> dna = Seq("CAGGTGCAGCTGGTGCAGAGCGGCAGCGAGCTGAAGAAACCTGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACGCCATGAACTGGGTCCGCCAGGCCCCAGGCCAGGGACTGGAATGGATGGGCTGGATCAACACCAACACCGGCAACCCCACCTACGCCCAGGGCTTCACCGGCAGATTCGTGTTCAGCTTCGACACCAGCGTGTCCACCGCCTACCTGCAGATCTGTAGCCTGAAGGCCGAGGACACCGCCGTGTATTNNTGTGCGA")    
>>> dna.translate()
Seq('QVQLVQSGSELKKPGASVKVSCKASGYTFTSYAMNWVRQAPGQGLEWMGWINTN...XCA', ExtendedIUPACProtein())

The TNN codon is valid, and it's translated to X, just as you suggested.

Cheers!!

• 0 views • link
written by Geparada Geparada

AHHH, Looks like my problem was my alphabet. I hadn't noticed that I was using UnambiguousDNA. Using generic_dna fixed the issue

• 0 views • link
written by Richard Richard

please mark the answer as accepted if you think that it's correct. You and the person who answered will receive extra score.

• 0 views • link
written by Giovanni M Dall'Olio Giovanni M Dall'Olio

Log in to answer this question.

More posts like this