Biostar Beta. Not for public use.
Why does bacterial codon table translate GTG start codon to V and not M?
0
Entering edit mode
15 months ago

Consider the following sequence:

>sequence
GTGACCGGCAGCGCGGCCACGATCCGCCCGGCCAAGGCGGCCGATGCGGTCGCGTGGGCG
CAGCTGCGTCTGGGCCTGTGGCCCGATGCCGATGATCCGCTGGAGACGCTGGTGGCGGCG
CTGGCCGAGGACGCAGGTGCGGTTTTCCTGGCGTGTGCAGCGGGTGGCCAGGCGATCGGC
TTCGCCGAAGTGCGCCTGCGCCATGACTACGT

In this bacterial organism, GTG is an alternative start codon. It means that it can initiate translation via an initiator-tRNA that puts in the amino acid Methionine (M) into the protein. However, if GTG occurs inside the sequence, it gets translated to valine (V) as usual.

However, when using programs that involve translating a nucleotide sequence to a amino acid sequence (such as EBI transeq online, command-line transeq or blastx with this sequence against it's translation starting with V), the above sequence will be translated to an amino acid sequence that begins with V regardless if the codon table is standard code or bacterial. In fact, even using command-line transeq option -methionine does not produce the desired M result.

Questions:

Why is GTG at the start of this sequence not translated to M when using the bacterial codon table?

What use is the bacterial codon table then, if it does not have a different behavior in this case (since this is the only major difference between standard or bacterial codon table)?

ADD COMMENTlink
0
Entering edit mode

How would the software know that what it was looking at was the first codon of the coding region, and not in the middle?

ADD REPLYlink
3
Entering edit mode
5 months ago
Joe 12k
United Kingdom

Your premise is wrong. It is an alternative start codon, because methionine isn’t required 100% of the time. It is valid for proteins to start with other amino acids, it’s just less common.

The tRNA for valine would recognise the codon as usual, not the fMet tRNA, so its not methionine being placed in to the first position at all.

In fact, such is biology’s disregard for what few rules we attempt to hold dear, that translation can actually occur from pretty much any initial codon. The degree of translation simply changes.

ADD COMMENTlink
0
Entering edit mode

In fact, such is biology’s disregard for what few rules we attempt to hold dear, that translation can actually occur from pretty much any initial codon. The degree of translation simply changes.

Thanks for sharing this one. I sort of fundamentally believed in the canonical start codons with exceptions occuring only in somewhat "exotic" organisms.

ADD REPLYlink
0
Entering edit mode

Are you sure the first amino acid in these proteins is Valine?

This is the ncbi entry for tuberculosis KatG, and it thinks the start codon is gtg, and the first amino acid is M

https://www.ncbi.nlm.nih.gov/nuccore/NC_000962.3?from=2153889&to=2156111&report=genbank&strand=true

ADD REPLYlink
0
Entering edit mode

Thank you for your fast reply. It really helped to better understand the situation. Very nice paper you linked as well.

So for clarification, this protein, for instance, is mistranslated?

https://www.ncbi.nlm.nih.gov/nuccore/JQ396378.1?report=fasta (starts with TTG) https://www.ncbi.nlm.nih.gov/protein/AFO09968.1?report=fasta (starts with M)

It should really start with L?

(...because TTG is translated to L when using transeq with the standard or bacterial codon table and it is not terribly surprising that errors exists in GenBank as it is not manually curated?)

ADD REPLYlink
1
Entering edit mode

You need to find out whether the sequence is experimentally determined or not. If it’s just an automatic annotation, it could be right, but could be wrong.

Also bear in mind that there isn’t a one size fits all bacteria codon table. The classic table 11 is essentially determined from E. coli, but frequencies and codon usage can vary between species.

ADD REPLYlink
0
Entering edit mode

It appears to be directly submitted and translated with table 11, so perhaps the people who directly submitted it had fallen for the same problem that I had. They saw TTG and thought M, when it is really L.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.3