This is a test version of Biostars. For the public version, visit https://www.biostars.org.
*.misa and *.statistic file differ in the identified ssr.

*.misa and *.statistic file differ in the identified ssr. The number of identified SSRs in *.statistic file is 216 but *.misa shows the detail of only 171 SSRs only. I have tried online and offline misa both but the result is same. Please suggest why is it so?? Which file to consider for the results in this case?

ssr misa
• 2,505 views • link
updated by Tm Tm • written by avnim • avnim

1 answer

What you are getting in .statistics and .misa is correct.

Number of SSRs in detail file are equal to following:

Total number of identified SSRs - Number of SSRs present in compound formation

See here for example:

Total number of sequences examined  740501
Total size of examined sequences (bp)   : 52204953
Total number of identified SSRs : 5595
Number of SSR containing sequences  : 4979
Number of sequences containing more than 1 SSR  : 530
Number of SSRs present in compound formation    : 320

So number of SSRs in my detail file will be 5595-320 = 5275

This happens as SSRs in compound formation are represented as (SSR)normal_sequence(SSR) as 2 SSRs are in single line:

For example:

(CCG)5ctcgcgcccgcgcccgcaaccaagaggaag(GCC)5

Thus in your case, number of SSRs in compound formation should be: 45

• 0 views • link
written by Tm Tm

thank you @toralmanvar for explaining in detail. But still have a doubt if we have to report number of ssr on basis of repeat type (for e.g. monomer-147, dimer-49) or abundance of SSR (like A/T- 120), so from where should I report .statistic file or by counting from detail .misa file.

• 0 views • link
written by avnim • avnim

That depends on your aim. However, you can always report whatever is obtained in .statistics file.

• 0 views • link
written by Tm Tm

thank you for your valuable suggestions.

• 0 views • link
written by avnim • avnim

Log in to answer this question.

More posts like this