If you're working with small values of k, I wrote a command-line k-mer counter called kmer-counter that will output results in a form that a Python script can consume:

https://github.com/alexpreynolds/kmer-counter

You can grab, build and install it like so:

$ git clone https://github.com/alexpreynolds/kmer-counter.git
$ cd kmer-counter
$ make
$ cp kmer-counter /usr/local/bin

Once the binary is in your path, you might use it in Python like so:

k = 6
fastaFile = '/path/to/some/seqs.fa'
kmerCmd = 'kmer-counter --fasta --k=%d %s' % (k, fastaFile)
try:
    output = subprocess.check_output(kmerCmd, shell=True)
    result = {}
    for line in output.splitlines():
        (header, counts) = line.strip().split('\t')
        header = header[1:]
        kmers = dict((k,int(v)) for (k,v) in [d.split(':') for d in counts.split(' ')])
        result[header] = kmers
    sys.stdout.write("%s" % (str(result)))
except subprocess.CalledProcessError as error:
    sys.stderr.write("%s" % (str(error)))

Given example FASTA like this:

>foo
TTAACG
>bar
GTGGAAGTTCTTAGGGCATGGCAAAGAGTCAGAATTTGAC

For k=6, you would get an iterable Python dictionary like this:

{'foo': {'TTAACG': 1, 'CGTTAA': 1}, 'bar': {'GTTCTT': 1, 'AGAACT': 1, 'GAGTCA': 1, 'ATGGCA': 1, 'GAACTT': 1, 'ATTCTG': 1, 'CTAAGA': 1, 'CTTCCA': 1, 'ATTTGA': 1, 'GGAAGT': 1, 'AGGGCA': 1, 'CCTAAG': 1, 'CTCTTT': 1, 'AATTTG': 1, 'TCTGAC': 1, 'TTTGCC': 1, 'CTTAGG': 1, 'TTTGAC': 1, 'GAAGTT': 1, 'CCCTAA': 1, 'AGAATT': 1, 'AGTCAG': 1, 'CTGACT': 1, 'TCTTAG': 1, 'CGTTAA': 1, 'GTGGAA': 1, 'TGCCAT': 1, 'ACTCTT': 1, 'GGGCAT': 1, 'TTAGGG': 1, 'CTTTGC': 1, 'TGGAAG': 1, 'GACTCT': 1, 'CATGCC': 1, 'GCAAAG': 1, 'AAATTC': 1, 'GTCAAA': 1, 'TGACTC': 1, 'TAGGGC': 1, 'AAGTTC': 1, 'ATGCCC': 1, 'TCAAAT': 1, 'CAAAGA': 1, 'AACTTC': 1, 'GTCAGA': 1, 'CAAATT': 1, 'TAAGAA': 1, 'CATGGC': 1, 'AAGAAC': 1, 'AAGAGT': 1, 'TCTTTG': 1, 'TTCCAC': 1, 'TGGCAA': 1, 'GGCAAA': 1, 'AGTTCT': 1, 'AGAGTC': 1, 'TCAGAA': 1, 'GAATTT': 1, 'AAAGAG': 1, 'TGCCCT': 1, 'CCATGC': 1, 'GGCATG': 1, 'TTGCCA': 1, 'CAGAAT': 1, 'AATTCT': 1, 'GCATGG': 1, 'ACTTCC': 1, 'TTCTTA': 1, 'GCCATG': 1, 'GCCCTA': 1, 'TTCTGA': 1}}

You can use standard Python calls to manipulate this dictionary object and get sums of counts per record, for sequence, etc. which seems to answer your question. Please feel free to clarify what you're looking for if this object representation is not clear.

For a fully-fleshed out demonstration, see: https://github.com/alexpreynolds/kmer-counter/blob/master/test/kmer-test.py

If you are working with large values of k, then you might look at other tools, like Jellyfish. They use data structures to give an approximate count for large values of k that are not tenable for strict word counts.