Hello everyone,

I have zero knowledge about bioinformatics and I am sorry about if this question comes as oblivious but I've done lots of research and couldn't find an answer.

Let's say I have FASTQ file and I need to find most frequent 25 K-mers (k=30) in this file. What should be the algorithmic approach?

Let's say file is something like this:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

@SEQ_ID
GATTTGGGAGTAAATCCATTTGTTCAACTCACAGTTTGTTCAAAGCAGTATCGATCAAAT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

What I do is, I first read the first line after @SEQ_ID and find all possible 30-mers (as substrings) from it, then I move on the second sequence after second @SEQ_ID and find 30-mers from there as well.

However, I couldn't find any information about: Should I concatenate these two strings together and look for k-mers there?

In other words, should I count (for example) last 10 characters of the first line and first 20 characters of second line as a k-mer?

Thank you