How to obtain compile core gene sequences from Roary? · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

How to obtain compile core gene sequences from Roary?

Hi guys, I would like to know how to obtain every single sequence of core genes from each organism from my Roary output to build phylogenetic trees out of. I've already run Roary and have the Gene Absence_Presence file, but it seems like it would take forever to check through every single gene identifier and try to match it with the sequence from the respective organism. Is there any code that I could use to maybe quickly parse through all these identifiers and give me the fasta files for each sequence? I'm still very new to coding so any help would be great. Thanks so much!

roary core genes pangenomics

• 2,055 views • link

updated 5.2 years ago by zhangdengwei

• written 6.0 years ago by ethanfoo360 •

1 answer

Hi, did you find a solution for it?

• 0 views • link

written 5.2 years ago by zhangdengwei

Log in to answer this question.

More posts like this

Core SNP tree VS. concatenated core genome tree
written 2.3 years ago by YiweiZhu •

There are two primary methods for generating multiple sequence alignment files necessary for constructing bacterial phylogenetic trees: the core SNP method and the core genome …
How to extract and concatenate fasta lines that match substring?
written 3.8 years ago by YOUSEUFS •

I have a list of unique identifiers identifiers = ['subject_1', 'subject_2'] and a multi-fasta file containing >CDS::subject_1::123 AAATTT >CDS::subject_1::354 CCCGGG >CDS::subject_2::789 GGGCCC >CDS::subject_2::765 TTTAAA how …
How to convert gbk file to roary tool acceptable gff3 format?
written 5.9 years ago by Kumar

I would like to carryout pan-genome analysis using `roary`, so I need to convert ` gbk` files to `roary` compatible ` gff/gff3` files (must have …
Filtering Whole Genome Sequence Data
written 6.4 years ago by Fid_o •

I have whole genome sequence data (.FASTA files) for Salmonella bacteria. On average the sequence files have a size of 4.7MB but there are some …
filtering some sequences from txt file in python
written 9.7 years ago by ashkan

I have too many lines like this: >ENSG00000100206|ENST00000216024|DMC1|2371|38568257;38570043|38568289;38570286 CTCAGACGTCGGGCCGACGCAAGGCCACGCGCGCGAACACACAGGTGCGGCCCCGGGCCA CACGCACACCGTACAC >ENSG00000001630|ENST00000003100|CYP51A1|3210|92134365|92134530 TATATCACAGTTTCTTTCTTTTTTTTTTTTTTTTTTTTGAGACAGAGTTTTGCTCTTGTT GCCCAGGCTGGAGTACAGTGACGCAATCTCGGCTCACTGCAACCTTTGCCTCCCAGGTTC >ENSG00000100206|ENST00000216024|DMC1|2371|38568257;38570043|38568289;38570286 TTAACTATAATCCCACTGCCTATTTTTTTATTTCTAAAAATATCATAAAAAGACACAAAA the first line(starting with `>`) is identifier and other lines …
Mutation annotation on tumor phylogenetic trees
written 10.2 years ago by ceruleanivy •

I have binary matrices with mutation presence absence for every patient where the first column contains an identifier for the mutation. So far, I have …
Obtaining phastCons conservation score for every gene in the Human genome
written 11.1 years ago by jeff.ohana •

Hey guys, Does someone has ever calculated the averaged PhastCons conservation score for every gene of the Human genome? One averaged conservation score for every …
How to obtain predicted or lab-verified TFBS in UCSC Genome Browser?
written 11.1 years ago by allyson1115ar •

I would like to obtain 2 data (any transcription factor will do) that have predicted or lab-verified transcription factor binding sites from UCSC genome browser. …
Suitable Database Management System For Storing/Querying Phylogenetic Trees
written 13.6 years ago by Fabsta

<p>Hi guys,</p> <p>I am interested in alternative ways of storing phylogenetic trees in a database.</p> <p>Currently, we represent trees as nested sets in a MySQL …
How Can I Get Protein Sequence In Fasta Format Using Taxon Id?
written 15.8 years ago by Luke

<p>I am working with bacterial genomes. I would perform a phylogenetic analysis using protein sequences. I have 65 organisms and 30 genes. How can I …