This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What Does "Repmatches" In Blat'S Psl Output Mean?

Hi,

I have a question about what repMatches means in BLAT's PSL format.

On BLAT's site it says Number of bases that match but are part of repeats, but I'm not sure if matches are counted just one time for the same repeat or matches are counted every time it is aligned to a repeat.

Thanks!

blat

1 answer

when you compare a sequence with a reference genome "masked", the repeat regions are lowercase, blat checks if the hit is in a lowercase region therefore it consider it's a repeat hit.

Does not seem to work for me ...

Please consider this sequence and region

chr11:75258534-75258583 in HG19

ttttcaaacttcagcctgcatcagaaacatctggagggcttggtaaaatc

This regions is repeat masked in hg19 FASTA file (lower case) and my blat output still says 0 for the repMatches.

A bit confused.

Log in to answer this question.