This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Reverse Complement of each coding regions

I have a fasta file which contains coding sequences as like this 

>Seq1
ATGAATGACAAAATTAA
GTTATATTTAAA 
TCCTTAATAACTTACCAGAAGAGACTAATGA
CATCTCATGCCATGAAG

I need to find Reverse Complement of each line and concatenate as like this 

>Seq1
TTAATTTTGTCATTCATTTTAAATATAACTCATTAGTCTCTTCTGGTAAGTTATTAAGGACTTCATGGCATGAGATG

Normally "cat fasta |tr ACGTacgt TGCAtgca | rev" will Reverse Complement but here I need to find for each CDS

sequence fasta reverse complement
• 1,170 views • link
written by the_cowa • the_cowa

How is this relevant for the original question @Pierre? OP is asking for reverse-complementing individual chunks of sequence on each line and then catting them together? It seems to be an odd/very specific request.

• 0 views • link
written by GenoMax GenoMax

Complement but here I need to find for each CDS

I understand the question as :" I want to find all the ORFs in the reverse complement."

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

I see. You included that as final solution assuming this is done first.

I need to find Reverse Complement of each line and concatenate as like this

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this