VCF to Fasta with out reference · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

VCF to Fasta with out reference

Hi,

I have a vcf file which contains multiple CDS from a mrna, I just need to convert that vcf to fasta with alt allele for het and hom sites(consensus). Yeah normally we will do with this bed tools and FastaAlternateReferenceMaker, but my question is with out an reference fasta is this possible to do the same?

vcf gatk

• 1,267 views • link

written 6.2 years ago by the_cowa •

how would you know what is in between the variants if you don't use reference sequence?

• 0 views • link

written 6.2 years ago by grant.hovhannisyan

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Efficiently Adding Missing 0/0 Sites to VCF from Whole-Genome Sequencing
written 2.6 years ago by Tobias •

Hey, from time to time I find myself wondering if there is a straight-forward way to add missing 0/0 sites at a set of positions …
Functional annotation with VEP: combine the same variant between the samples in the same line (ques…
written 4.7 years ago by Adham •

Dear colleagues I used VEP to annotate a multisamples vcf file, but I get separate lines of the same variant, which corresponds to each sample. …
Building vcf from most common alleles
written 5.0 years ago by Eugene •

I have a vcf file that contains variant calls at many sites across multiple [haploid] samples (FreeBayes or GATK output). The sequenced samples are derivatives …
How to convert allele column of HapMap genotype data format into REF and ALT columns of VCF format?
written 5.8 years ago by Abbas.M •

How can we convert Allele column of Hapmap SNP genotype data format into ALT and REF columns of VCF format? In HapMap format, there is …
Reverse Complement of each coding regions
written 6.1 years ago by the_cowa •

I have a fasta file which contains coding sequences as like this >Seq1 ATGAATGACAAAATTAA GTTATATTTAAA TCCTTAATAACTTACCAGAAGAGACTAATGA CATCTCATGCCATGAAG I need to find Reverse Complement of each …
Generating fasta from VCF with only the variant
written 6.2 years ago by the_cowa •

Hi Stars, I did an alignment and from that, I called the variant (VCF). So my question is how I can convert that vcf into …
Calculate allele frequency from many VCF files in specific locus
written 6.4 years ago by John

Dear all, I have 100 VCF files (100 different samples). I would like to calculate allele frequency in specific sites. In one specific locus I …
Calling haploid consensus sequence from vcf
written 7.3 years ago by philodendron •

Hi there, I have a filtered VCF file of mtDNA genotypes for multiple individuals. The calls are haploid and therefore the genotype field in the …
Substituting heterozygous sites by randomly sampling one allele
written 10.3 years ago by outlier95 •

For those familiar with GATK, FastaAlternateReferenceMaker (unless the --useIUPAC flag is added) always uses the alternate allele at heterozygous SNP sites. I would like to …
Pileup viewer for VCF v4.2
written 11.8 years ago by Lee Katz

Hey BioStars, sorry to flood you so much with my bcftools questions. Since I have merged my VCFs, it turns out that they are now …