Hi
I have around 85 gene sequences in individual fasta files. I'd like to rename each file with their header name containing the gene name in [gene=]. For each header, I only want what is in-between the brackets. I'm trying to do this through linux commands.
in fasta file input
>lcl|NC_018552.1_cds_YP_006666009.1_1 [gene=rps12] [locus_tag=C329_pgp044] [db_xref=GeneID:13540299] [protein=ribosomal protein S12] [exception=trans-splicing] [protein_id=YP_006666009.1] [location=complement(join(100912..100937,101474..101705,72928..73041))] [gbkey=CDS]
ATGCCAACTATTAAACAACTTATTAGAAATACAAGACAGCCAATCAGAAATGTCACGAAATCCCCCGCTC
>lcl|NC_018552.1_cds_YP_006666010.1_2 [gene=psbA] [locus_tag=C329_pgp089] [db_xref=GeneID:13540179] [protein=photosystem II protein D1] [protein_id=YP_006666010.1] [location=complement(565..1626)] [gbkey=CDS]
ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTCGCTTCTGTAACTGGATAACTAGCA
in need fasta file output
>rps12
ATGCCAACTATTAAACAACTTATTAGAAATACAAGACAGCCAATCAGAAATGTCACGAAATCCCCCGCTC
>psbA
ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTCGCTTCTGTAACTGGATAACTAGCA
Can anyone help with this?
TIA
•
written
by
sebabiokr •
I've got a general method, but you need to have some basic knowledge of regular expressions. If not, please learn them for 30 minutes:
After that, you can easily understand what gene=(.+?)\] means.
$ seqkit seq -i --id-regexp 'gene=(.+?)\]' seqs.fasta
>rps12
ATGCCAACTATTAAACAACTTATTAGAAATACAAGACAGCCAATCAGAAATGTCACGAAA
TCCCCCGCTC
>psbA
ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTCGCTTCTGTAACTGG
ATAACTAGCA
Yes, Its perfectly working.. It will be useful if you share concat command too if there are same genes in the fasta file Thank you
Assuming that you have a directory containing multiple files with .fasta extension, each containing one record, you can do something like:
for f in $(ls -1 *.fasta); do name=$(head -1 $f | sed 's/.*\[gene=\([a-zA-Z0-9_]*\).*/\1/'); mv $f $name".fasta"; done
Also, this can be easily achieved using a short python script, so you might consider that as well.
Thank you for your code, but i have a fasta file which contains [gene=rps12] ids, so i want to rename the header with gene id alone like >rps12 atgcgtacg.
Log in to answer this question.
This type of question is among the most frequently asked on this forum. Searching through previous posts should give you several different options of doing this task.
Yes there are many answer in this forum but they are specific to header line. it doesnot work with my header line and its difficult for me to change the command by myself. TIA
i tried this command
awk -F 'gene=|]|[.]{1}' '/^>/ {print $2}' 7seqNC_018552.1cds.fasta > 7NC_018552.fasta
got only gene name alone without contig seq in out. Any help appreciated