How can I count the symbols in a given string / text and, as a result of that count, remove the characters
f = open('Denv4-X-gb_AY947539.txt', 'r')
z = f.read()
count_inicio = sum(map(lambda x : 1 if '-' in x else 0, z))
count_fim = sum(map(lambda x : 1 if '-' in x else 0, reversed(z)))
print(count_inicio, count_fim)
Output>
479 479
file contents:
lcl|NC_002640.1_cds_NP_073286.1_1 [gene=POLY] [locus_tag=DV4_gp1]
[db_xref=GeneID:5075729] [protein=polyprotein]
[protein_id=NP_073286.1] [location=102..10265] [gbkey=CDS]
------------------------------------------------------------ ---------------------------------atgaaccaacgaaaaaaggtggttaga ccacctttcaatatgctgaaacgcgagagaaaccgcgtatcaacccctcaagggttggtg
aagagattctcaaccggacttttttctgggaaaggacccttacggatggtgctagcattc
atcacgtttttgcgagtcctttccatcccaccaacagcagggattctgaagagatgggga
cagttgaagaaaaataaggccatcaagatactgattggattcaggaaggagataggccgc
------------------------------------------------------------
gb:AY947539|Organism:Dengue virus 4|Strain
Name:H241|Segment:null|Subtype:4|Host:Human
ggtcgtgtggaccgacaaggacagttccaaatcggaagcttgcttaacacagttctaaca
gtttgtttagatagagagcagatctctggaaaaatgaaccaacgaaaaaaggtggttaga
ccacctttcaatatgctgaaacgcgagagaaaccgcgtatcaacccctcaagggttggtg
aagagattctcaaccggacttttttccgggaaaggacccttacggatggtgctagcattc
atcacgtttttgcgagtcctttccatcccaccaacagcagggattctgaaaagatgggga
cagttgaagaaaaacaaggccatcaaaatactgactggattcaggaaggagataggccgc
atgctgaacatcttgaatggaagaaaaaggtcaacaatgacattgctgtgcttgattccc
For example I need to take the sequence lcl | NC_002640.1_cds_NP_073286.1_1> --- AATG-GG ---- and count the number of "-" at the beginning and end
And then cut into Myseq1 gb: AY947539 | Organism: Dengue virus 4 | GGGAATG-GGAAAA characters according to the amount of "-"
TALE 3 "-" in Myseq start and 3 at the end 4 ... So the output I want is AATF-GG. But first I need to make this "-" count from the beginning and the end.
How do I count symbols in a given string / text and as a result of that count remove characters from another string / text in the same file?
0 answers
No answers yet.
Log in to answer this question.
More posts like this
1) first understand your format, looks like some multiple alignment format, so you can check if BioPython has a module to read it
2) if not, you need to read your sequences, you have a header of 3 lines in the first sequence (is it not a single line? that facilitates reading it), and a header of 2 lines in sequence 2, then each block has the nucleotide sequence, so add the sequence 1 in a string and iterate over it to get "-"
3) load the sequence 2 in another string and remove the blocks (use string ranges)
The header is on the same line in my FASTA file. And I turned it into txt because I couldn't read it with biopython. The alignment was done with mafft
arquivo.fasta.aln ou arquivo.aln turned into txt
Could you give an example
Input:
output:
I need to count the number of "-" of the first string and cut the characters of the second string according to that amount find a second string ... To be only with the CDs in the second string
Por favor cara, precisamos um Input e Output esperado;
Per exemplo:
Input:
Desired output:
ok you can check now