This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How do I count a number of ("-") in a reference string and remove it in a second string?

When counting the number of characters at the beginning of a string or the end of a string, the result is 0. What do I do? 

f = open('Denv4-X-gb_AY947539.txt', 'r') 
z = f.read()
e = sum(1 for _ in it.takewhile(lambda c: c == '-', z)) 
y = sum(1 for_ in it.takewhile(lambda c: c == '-', reversed(z)))
print(e,y)

Output:

> 0

The file is being read normally ....

What's in the file:

>lcl|NC_002640.1_cds_NP_073286.1_1 [gene=POLY] [locus_tag=DV4_gp1] [db_xref=GeneID:5075729] [protein=polyprotein] [protein_id=NP_073286.1] [location=102..10265] [gbkey=CDS]
------------------------------------------------------------
---------------------------------atgaaccaacgaaaaaaggtggttaga             
ccacctttcaatatgctgaaacgcgagagaaaccgcgtatcaacccctcaagggttggtg
aagagattctcaaccggacttttttctgggaaaggacccttacggatggtgctagcattc
atcacgtttttgcgagtcctttccatcccaccaacagcagggattctgaagagatgggga
cagttgaagaaaaataaggccatcaagatactgattggattcaggaaggagataggccgc
------------------------------------------------------------
>gb:AY947539|Organism:Dengue virus 4|Strain Name:H241|Segment:null|Subtype:4|Host:Human
ggtcgtgtggaccgacaaggacagttccaaatcggaagcttgcttaacacagttctaaca
gtttgtttagatagagagcagatctctggaaaaatgaaccaacgaaaaaaggtggttaga
ccacctttcaatatgctgaaacgcgagagaaaccgcgtatcaacccctcaagggttggtg
aagagattctcaaccggacttttttccgggaaaggacccttacggatggtgctagcattc
atcacgtttttgcgagtcctttccatcccaccaacagcagggattctgaaaagatgggga
cagttgaagaaaaacaaggccatcaaaatactgactggattcaggaaggagataggccgc
atgctgaacatcttgaatggaagaaaaaggtcaacaatgacattgctgtgcttgattccc

I would like to know how to print the "-" number at the beginning and end of the first text:

before starting

>lcl|NC_002640.1_cds_NP_073286.1_1 [gene=POLY] [locus_tag=DV4_gp1] [db_xref=GeneID:5075729][protein=polyprotein] [protein_id=NP_073286.1] [location=102..10265] [gbkey=CDS]

Blockquote

>gb:AY947539|Organism:Dengue virus 4|Strain Name:H241|Segment:null|Subtype:4|Host:Human.

.

f = open('Denv4-X-gb_AY947539.txt.txt', 'r')
con = f.readlines()
con = [i.strip() for i in con]
length = len(con[0].split(" ")[1])
result = f'{con[1].split(" ")[0]} {con[1].split(" ")[1][length:]}'
print(result)
f.close()

f = open('file.txt', 'a')
f.write(f'\n{result}')
genome alignment sequence
• 499 views • link
updated by Jorge Amigo Jorge Amigo • written by USER • USER

Can you please tidy your post? Please use the 101 010 button, not the quotation one:

• 0 views • link
written by Kevin Blighe Kevin Blighe

I have done the changes

• 0 views • link
written by USER • USER

1 answer

If a perl solution can be considered, here are my 2 cents:

perl -pe 'if (/^>/) { $. > 1 and print "\n" } else { chomp }' sequences.fa \
| perl -pe '/^(-*)\w+(-*)$/ and printf "%s %s\n", length($1), length($2)'

The first perl section linearizes the fasta file, and the second perl section writes the number of "-" characters at the beginning and at the end of the sequence.

• 0 views • link
written by Jorge Amigo Jorge Amigo 
import itertools as it

f = open('Denv4-X-gb_AY947539.txt', 'r') z = f.read() count_inicio =
sum(map(lambda x : 1 if '-' in x else 0, z))  count_fim =
sum(map(lambda x : 1 if '-' in x else 0, reversed(z))) 
print(count_inicio, count_fim)

I tried this solution in Python, but the output is 459,459

For example I need to take the sequence lcl | NC_002640.1_cds_NP_073286.1_1> --- AATG-GG ---- and count the number of "-" at the beginning and end

And then cut into Myseq1 gb: AY947539 | Organism: Dengue virus 4 | GGGAATG-GGAAAA characters according to the amount of "-"

TALE 3 "-" in Myseq start and 3 at the end 4 ... So the output I want is AATF-GG. But first I need to make this "-" count from the beginning and the end.

How do I count symbols in a given string / text and as a result of that count remove characters from another string / text in the same file?

• 0 views • link
updated by Jorge Amigo Jorge Amigo • written by USER • USER

Problem again with your code

• 0 views • link
written by Kevin Blighe Kevin Blighe

Please! Help me! I need to solve this problem and I am not getting a solution to my problem

• 0 views • link
written by USER • USER

This is not a Python solution, but Perl, and it's meant to be run in a unix/linux command line. Also, the sequences.fa file is expected to have unix EOL, so if that's not the case you may have to preprocess it with dos2unix or mac2unix.

Also, this solution addresses exactly what your question was about: counting the "-" characters at the beginning and at the end of each sequence. If you need to do something, just explain everything in a single question rather than opening different ones. This site's spirit is to help users to find their own solutions, rather than to solve user's problems.

• 0 views • link
written by Jorge Amigo Jorge Amigo

Log in to answer this question.

More posts like this