Hi Heng
I think there could be a possible bug in the seqtk trimfq option. here is a contrived example. If I run this read through it I get back the same read. I am using the latest version from github.
@2260:7:1101:14363:3089/1
CCTGCATTCTCACTCGTGTGGGCTCCACGACTGGGTCACCCCGCCGCTTCACTGCCCACACGACGCTCCCCTACCCATCCACACACCCGGCACGAATGCAGGTTCTTGTGTGAATGCCACGGCTTCGGTGGGGGGTTTGAGCCCCGCTCC
+
bbbeeeeegggffihhhhiihihihiiiihiifihhiiihihhhghgggeeeeeddcdcccccc^accaccc^a[^bcc`[bbcccWX]accccacccc`ba[bbccb]`^^bcdccc_b]]TX[bBBBBBBBBBBBBBBBBBBBBBBBB
i think the space in the read is getting messed up but I think you can get the idea.
Expected result : below is a just a made up answer but I would expect the trimming algo to remove low quality bases from both end and beginning. In this this case the last ~24 bases of the read are low quality (ASCII(B) - 64 = 2 ) and should be trimmed.
@2260:7:1101:14363:3089/1
CCTGCATTCTCACTCGTGTGGGCTCCACGACTGGGTCACCCCGCCGCTTCACTGCCCACACGACGCTCCCCTACCCATCCACACACCCGGCACGAATGCAGGTTCTTGTGTGAATGCCACGGCTTC
+
bbbeeeeegggffihhhhiihihihiiiihiifihhiiihihhhghgggeeeeeddcdcccccc^accaccc^a[^bcc`[bbcccWX]accccacccc`ba[bbccb]`^^bcdccc_b]]TX[b
-A
•
written
by
Abhi
1 answer
I think this is an issue of encoding. In the Sanger encoding the offset is 33 so B stands for a quality of 66 -33 = 33, pretty good.
Previous Illumina encodings used a different ASCII offset (64) in which case B would stand for a quality of 2, bad.
well that is the current standard, over the long term is better that way
search for some tips on converting fastq, for example: Convert Illumina reads to Sanger score
Thanks for the suggestion. I am aware that various tools can do this but I like to avoid using multiple tools if things can be done with one. The seqtk documentation has an example to convert ILLUMINA 1.3+ FASTQ to FASTA which made me expect that it could do the conversion for me but apparently it cannot do that after all.
Log in to answer this question.
you should also state of what you expect to see and why. It is not obvious from your example.
edited the question with expected answer. I assumed that it was obvious my bad.