I am using gatk-4.1.7.0 version with following command, however I am getting error. please advice....
Command:
gatk-4.1.7.0$./gatk HaplotypeCaller -R /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa -I /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam -O /home/kumarm/allan-work/RNASEq-alignment/raw_variants.vcf
ERROR:::
A USER ERROR has occurred: The specified fasta file (file:///home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa) does not exist.
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
•
written
by
Kumar
1 answer
Hi Manoj
That's a header incompatibility issue and can be resolved by editing your reference fasta file. Here are few suggestions:
check the headers of your reference fasta file:
grep "^>" /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.facheck the header of your bam file :
samtools view -H /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam
If your sequence with header KF267450.1 is not found or partially found in the output from step#2 above,then either you have used a difference reference for alignment or you need to rename the BAM header to match with the reference fasta headers.
Log in to answer this question.
-
GATK GenomicsDBImport update database error using snakemake
written by Peter Chung
-
index fasta file for HaplotypeCaller
written by Mojtaba •
-
Error message when running a GATK SelectVariants: no positional argument is defined for this tool
written by mohsamir2016 •
-
Gatktools
written by bestone •
-
Nextflow Gatk DepthOfCoverage: Failure working with the tmp directory
written by Eliveri •
-
Estimation of normal/tumor pairs contamination using Conpair - Compatibility with GATK4
written by Huma •
-
GATK HaplotypeCaller Error
written by sahar.salimi92 •
-
Variant calling using GATK::ERROR
written by Kumar
-
Struggling to use the GATK HaplotypeCaller on my bam files.
written by lovegenetics •
-
HaplotypeCaller java error
written by lmobuchon •
Please check the path you have specified for reference sequence. Error clearly tells that there is no reference fasta in the path provided.
The error because I have not generated .dict and .fai files with reference.fasta. However, now I have provided these so it is showing following ERROR:
A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
Hi I have fastq (MnION) file and a reference fasta file..I have still issue to not getting results ......
--FILE 1
@ID_5331388 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCC +ID_5331388 AAFFFJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJ7FFJJJJJJJJJFJJJFJJJJJJJJJJJJJFJJJJJJJJJJJJJJJ @ID_6694963 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGCTGGGAATTCTCCTCCACTCTGGGATGGGCATTCTCCTCC +ID_6694963 AAAFFJJJJJJJFJJJJJFJJFJJJJJJJJJJJJJJFJJJF<fjjjjjjjjj-aj<-ajf-7jff7--7<7fffjj-<<aa-ff-<faj))-af-----)< p="">
---FILE 2
--ERROR--
A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []