This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove double vertical bar "||" at the end of the sequence in a fasta file

Hello I have a fasta file as 

>jgi|FusspF23_1|104542
GGTTCTCTTGTCTGTTTTTAAAAGAGTCTCGAGACCCC||
>jgi|FusspF23_1|10121
GGGGCCGCCCTCGATTCATCAGCGAAATTGCTCAGTCGGGCG||

at the end of fasta sequence I have these symbols "||" which I want to remove. I tried using sed but in that way I will end up removing that symbol "|" in fasta sequence description line ">jgi|FusspF23_1|104542" which I don't want.

Please help.

Thank you, Ambika

awk sed fasta
• 2,334 views • link
updated by AK AK • written by AP • AP

4 answers 

sed 's/[\|]*$//' in.fasta
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thanks you so much it works.

• 0 views • link
written by AP • AP

If an answer was helpful, you should upvote it; if the answer resolved your question, you should mark it as accepted. You can accept more than one if they work.
Upvote|Bookmark|Accept

• 0 views • link
written by GenoMax GenoMax

We could also have sed match the first character of a line and replace only when the line does not start with a >:

sed '/^[^>]/s/|//g' in.fasta
• 0 views • link
written by Ram Ram 
awk '{gsub("\\|\\|","");print}' in.fasta
• 0 views • link
written by ATpoint ATpoint 
cat file.fasta | tr -d '||' > fixed.fasta
• 0 views • link
written by Joe Joe 
perl -pe 's/\|+$//' in.fasta
• 0 views • link
written by AK AK

Log in to answer this question.

More posts like this