Hello,

I am new to processing PacBio data so please excuse me for a naive question.

I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’

When running lima from the IsoSeq3 pipeline, we need to give primers.fasta file in the form of 5p and 3p sequences. Can you help me how I can use these sequences in the 5p and 3p format?

Thanks!