This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Getting "Mismatch between read length and quals length" error in SortSam.

I am running Picard's SortSam (with VALIDATION_STRINGENCY = LENIENT) and I'm getting the following error. The SAM file was generated using BWA mem. I'm not familiar with this issue and haven't found much information on it. How can I resolve this?

Here is the stack trace:

Exception in thread "main" java.lang.RuntimeException: Mismatch between read length and quals length writing read E00170:444:HG3MJALXX:2:1210:10216:16059; read length: 151; quals length: 32 
      at htsjdk.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:170) 
      at htsjdk.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:40) 
      at htsjdk.samtools.util.SortingCollection.spillToDisk(SortingCollection.java:255) 
      at htsjdk.samtools.util.SortingCollection.doneAdding(SortingCollection.java:220) 
      at htsjdk.samtools.util.SortingCollection.iterator(SortingCollection.java:291) 
      at htsjdk.samtools.SAMFileWriterImpl.close(SAMFileWriterImpl.java:223) at picard.sam.SortSam.doWork(SortSam.java:167) 
      at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:282)
      at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:103) 
      at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:113)
genome picard sortsam
• 1,794 views • link
written by claudiadast • claudiadast

show us the output of

grep -F  'E00170:444:HG3MJALXX:2:1210:10216:16059' in.sam
• 1 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

The output is:

E00170:444:HG3MJALXX:2:1210:10216:16059 99      chr2    91792176        42      151M    =       91792243     218      AGCCCTTCTCAATAGCCATTTTGAAATATATCAAGGAAATATATTTAGGGGTAAAATATATTAGTTTCCCTCATACAGCTATAAAACATACAGGAATAATTTTTGTCAATGTCTACTACAAATCCAATATAGCAGTAATTATAAAACTCAC       ?<<==>><=<==<=====<====<==<=<=<<
• 1 views • link
written by claudiadast • claudiadast

you sam file is truncated. That's not a problem with picard but with your upstream process.

• 1 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Problem in converting SAM to BAM file by DROP SEQ
    written by VANSHIKA • VANSHIKA
    Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing SAM header. @RG line missing SM tag. Line: @RG ID:staralign1; ; Line number 10 at htsjdk.samtools.SAMTextHeaderCodec.reportErrorParsingLine(SAMTextHeaderCodec.java:258) at htsjdk.samtools.SAMTextHeaderCodec.access$200(SAMTextHeaderCodec.java:46) …
  • Error due to Sam to Bam and Indexing using picard
    written by smrutimayipanda • smrutimayipanda
    Hii all, I ran the following command: picard SortSam -I 10100123749_NIKEC.bam -O 10100123749.bam --SORT_ORDER coordinate --MAX_RECORDS_IN_RAM 1500000 --VALIDATION_STRINGENCY LENIENT But I am getting this error: …
  • picard sortsam error
    written by antonioggsousa antonioggsousa
    Hi, Does anyone come across this error in `picard SortSam` command? ([site](https://broadinstitute.github.io/picard/index.html#GettingHelp)) The command run: java -Djava.io.tmpdir=$TMP_SPACE -jar $PICARD \ SortSam I=$IN_BAM O=$OUT_BAM SORT_ORDER=coordinate \ …
  • Revert bam to fastq
    written by MAPK MAPK
    I am trying to revert bam to fastq. I am using docker to do this. My docker image was running fine for samples from other …
  • The Picard FilterSAM READ is throwing error
    written by a.james a.james
    Dear All, I am using Picard `FilterSamReads` for filtering a list of sorted reads from a read_name/_id sorted BAM file. I am wanna sort the …
  • picard markduplicate output smaller file
    written by Peter Chung Peter Chung
    I am new in WGS analysis. First, I combine all my bam files into one and it's 157GB and then add read group on it …
  • picard CollectInsertSizeMetrics error
    written by sunnykevin97 sunnykevin97
    Hi, why Im getting the error message using picard insert-metrics only on some bam files ? **Error** xception in thread "main" htsjdk.samtools.SAMFormatException: **SAM validation error: …
  • SortVCF in Picard
    written by Maheswari P • Maheswari P
    i am working on SORTVcf picard tool. **java -jar picard.jar SortVcf I=filename.vcf o=output.vcf** SEQUENCE_DICTIONARY=reference.dict I am getting error as Exception in thread "main" java.lang.IllegalStateException: Key …
  • Picard tool SortVcf gives an empty result file
    written by haiying.kong haiying.kong
    I have downloaded dbSNP data and trying to sort the .vcf file with the command line: java -Xms10g -Xmx20g -Djava.io.tmpdir=tmp -jar picard.jar SortVcf INPUT=00-All_chr.vcf OUTPUT=00-All_chr_sorted.vcf …
  • Problem replacing contigs in a dbsnp vcf using Picard SortVcf
    written by idedios • idedios
    Right now I'm trying to change the contigs in the dbsnp vcf to match those of my reference genome (from 1, 2, ..., Y, MT …