How to process the raw reads from miRNA-seq
Hi,
Many studies reported the peak length of miRNA of 22 nt in fishes. However, I obtained the peak length of 24 nt. Is there any mistakes in the data processing?
The raw reads were obtained by illumina hiseq xten sequencing, and were processed with the program cutadapt to trim the adaptor sequence (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCAC) from the 3' end. Reads with poor quality, or shorter than 18 nt were also removed.
Should I cut one base for per read in its 5' and 3'?
• 1,927 views
•
link
updated
by
k.kathirvel93
•
written
by
smallfish •
•
written
by
smallfish •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
miRNA low mapping ratings
written by Ant •
-
how to removed the first two nucleotides from a fastq file (single-end)
written by 17318598206 •
-
miRNA length distribution
written by LynxLynx •
-
Excessive data loss after trimming
written by jomagrax •
-
Extract gRNA sequence using cutadapt
written by Swimming bird •
-
miRNA fastqc sequence length distribution with UMI
written by maria2019
-
Removing adaptors from smallRNA seq data
written by juan.crescente •
-
Interpreting trim_galore report
written by vaslanzadeh •
-
mapping read is low for miRNA data after trimming
written by cyn.liu •
-
Output files are empty after adapter trimming using trim galore
written by nalandaatmi •
Some aligners should be able to soft-clip the bases on end. You want to use an ungapped alignment. If you try
bbmap.shfrom BBMap suite use these parameters:ambig=all vslow perfectmode maxsites=1000for miRNA.You can also check your reads with fastqc or similar before/after trimming. The "per base sequence content" will tell you what are the "extra" nucleotide at the 5' or 3' end.