Hi everyone!

I am trimming the adapters of my data, for one of the controls cutadapt It's only keeping the 5.2% of the reads after trimming and removing reads shorter than 17bp

$ cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -j 4  -m 17 -o control_2_trimmed.fastq control_2.fastq

=== Summary ===

Total reads processed:               5,252,641
Reads with adapters:                 5,169,644 (98.4%)
Reads that were too short:           4,981,734 (94.8%)
Reads written (passing filters):       270,907 (5.2%)

Total basepairs processed:   262,632,050 bp
Total written (filtered):      8,801,796 bp (3.4%)

While for the other samples values around 40% are obtained. Is the problem somehow my foult or coud It be from the data?

Thank you in advance, Jose