This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to convert string into fasta using bash?

Hi, I have a string of a fasta file (see below). You can see it's already in a fasta format, but its got spaces in the ID, and has newline characters. I have a Perl solution for this, but it's a bit hokey. I was wondering if any of you have the bash skills to turn this into a regular fasta?

Input:

">GA1redu 691-707f 57.9 product 2894bp 2006\r\nGCAGGACTCGGCTTGCT\r\n>HIVRES2redu \r\nGCTCTTGATAAATTTGATATGTCCAT"

Ideal Output:

>GA1redu 691-707f 57.9 product 2894bp 2006
GCAGGACTCGGCTTGCT
>HIVRES2redu
GCTCTTGATAAATTTGATATGTCCAT
fasta perl bash string
• 3,088 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by SaltedPork SaltedPork

Another way is to use sed - echo -e '.....' | sed 's/\r//g' - which remove "\r" in your text.

• 0 views • link
written by John John

2 answers 

echo -e '>GA1redu 691-707f 57.9 product 2894bp 2006\r\nGCAGGACTCGGCTTGCT\r\n>HIVRES2redu \r\nGCTCTTGATAAATTTGATATGTCCAT' | tr -d '\r'
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Pierre mate, I feel pretty silly given how simple the solution is. Thanks!

• 0 views • link
written by SaltedPork SaltedPork

Or very easy change field separator "\r\n" to new one "\n" in awk like: echo -e '.....' | awk '$1=$1' FS="\r\n" OFS="\n" this is very easy to read and understand.

• 0 views • link
written by Paul Paul

Log in to answer this question.

More posts like this