how to find Adapter Sequences.

I am to trying to find out the Adapter sequence of the GEO DATASETS With GEO ID GSE71819.I Have found this
GEO ID From https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5031959/ or http://www.ncbi.nlm.nih.gov/geo/query/acc.

please help me how I can find out the adapters..

sequence

• 3,453 views • link

updated 8.8 years ago by ATpoint

• written 8.8 years ago by dpktiwari168 •

1 answer

The paper method section states that this kit was used:

TruSeq Small RNA Sample Preparation Kits

Then you check the Illumina Adapter Sheet, which leads you to page 23 of the pdf:

TruSeq Small RNA

RNA 5’ Adapter (RA5): 5’ GUUCAGAGUUCUACAGUCCGACGAUC

RNA 3’ Adapter (RA3): 5’ TGGAATTCTCGGGTGCCAAGG

If you have no information at all about the library prep, you can always try and use FastQC on the fastq files to check for adapter content and overrepresented sequences.

• 0 views • link

written 8.8 years ago by ATpoint

Thank you So much for your help..

• 0 views • link

written 8.7 years ago by dpktiwari168 •

More posts like this

miRNAs - Adapters, adapters, adapters i´m so confused
written 1.4 years ago by omicon •

Hello everyone, I hope you can help me. I am trying to improve my bioinformatics skills, and currently, I am working on obtaining raw count …
COnversion of REF_ID into gene name (or the other way around)
written 4.1 years ago by klabunde •

Dear all, I'm trying to find published datasets regarding the transcriptomic reaction of mice lungs to Streptococcus pneumoniase infection. I found datasets on GEO, I …
Where is clonotypes .csv file
written 4.3 years ago by yueli7

Hello, I tried to analysis following datasets: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5210599, or https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5808300. In the VDJ_Analysis: https://github.com/ucdavis-bioinformatics-training/2020-Advanced_Single_Cell_RNA_Seq/blob/master/data_analysis/VDJ_Analysis_fixed.md It should has two files: 1. filtered_contig-annotation.csv, 2. clonotypes.csv. Where I …
Map from GEO samples' name to TCGA name
written 9.1 years ago by landscape95

I am working on several GEO data sets, the samples are GSMxxx, can these samples be converted to TCGA format type TCGA-xx-xx. For example, data …
Meaning of RMA Values
written 10.0 years ago by Steve •

Hello All, I am new to the bioinformatics field. I came across this dataset and I was curious to what ID_REF means and what the …
GEO datasets: Raw data is available on Series record
written 10.4 years ago by aharnishi02

I am new to lot of these genomics efforts. I have some basic questions on expression datasets found in GEO. The raw files of some …
I need to know how to trimming RNAseq of GEO dataset.
written 11.1 years ago by silas008

I need to trimming the adapters of a GEO NCBI RNAseq. Link http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28888 The fastqc shows that there are some Ilumina primeira and adapters. But …
How To Understand The Encoding And Trim Their Adapters
written 12.6 years ago by bmechuangye •

Hi, I am puzzled how to change the encode to Sanger format phred+33 of the data and how to trim the adapter sequence? I have …
How To Merge Two Microarrays Datasets?
written 13.2 years ago by fbrundu

Hi all, I am trying to merge two microarrays datasets, as in <a href='http://www.nature.com/nm/journal/v19/n5/fig_tab/nm.3175_F1.html'>this paper</a>. I did not understand how to do it because the …
Where To Find Rnas Used In Gene Expression Studies?
written 13.2 years ago by Click downvote

I have found several datasets that use the transcriptome from the hippocampus in mice and humans. I am very interested in getting the transcriptome from …